Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting polymorphism of VKORC1 and CYP2C9 genes

A technology of gene polymorphism and kit, applied in the determination/testing of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of individual differences in warfarin dosage and limited influence of non-genetic factors , to achieve high accuracy, good specificity, and low false positive results

Active Publication Date: 2012-01-25
李艳 +1
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the degree of influence of non-genetic factors is relatively limited and is not the main reason for individual differences in warfarin dosage

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting polymorphism of VKORC1 and CYP2C9 genes
  • Kit for detecting polymorphism of VKORC1 and CYP2C9 genes
  • Kit for detecting polymorphism of VKORC1 and CYP2C9 genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 Preparation of kit of the present invention

[0033] The kit of the present invention consists of the following:

[0034] (1) Human peripheral blood genome extraction reagents are: deionized water, 6M NaI, chloroform / isoamyl alcohol (24:1) mixture, isopropanol and absolute ethanol.

[0035] (2) Primers:

[0036] 1) VKORC1 exon 3 gene

[0037] The upstream primer sequence is: 5′-CAGTGCCTGAAGCCCACA-3′,

[0038] The downstream primer sequence is: 5'-CTCACATGCCAAAGCAAAGC -3';

[0039] 2) CYP2C9 exon 3 gene

[0040] The upstream primer sequence is: 5'-GCTGTTAAGGGAATTTGTAGG-3',

[0041] The downstream primer sequence is: 5'-ATATTCACCCAAGGCTGTCT-3';

[0042] 3) CYP2C9 exon 7 gene

[0043] The upstream primer sequence is: 5'-GTGCCATTTTTCTCCTTTTCC -3',

[0044] The downstream primer sequence is: 5'- AATGTCACAGGTCACTGCATG -3'.

[0045] The above primer sequences were synthesized by Shanghai Life Technology Biotechnology Company.

[0046] (3) Negative con...

Embodiment 2

[0055] Example 2 Using the kit prepared in Example 1 to detect the gene polymorphisms of VKORC1 and CYP2C9

[0056] Take the results of detecting the gene polymorphisms of VKORC1 and CYP2C9 in the peripheral blood samples of 20 patients who need to use warfarin as an example.

[0057] Detection process: First, design specific primers based on the VKORC1 and CYP2C9 gene sequences provided by the NCBI nucleic acid database. Obtain peripheral blood samples from patients who are clinically using warfarin drugs, use whole blood DNA extraction reagents to extract peripheral blood DNA, prepare PCR reaction solution for PCR amplification, then recover PCR amplification products, perform sequencing reactions, and sequence reactions after completion After the product was purified, it was sequenced, and finally the nucleic acid sequence was compared in the NCBI nucleic acid database to determine the sequence polymorphism.

[0058] Specific steps are as follows:

[0059] (1) Extract...

Embodiment 3

[0069] Embodiment 3 Evaluation of the detection ability of the kit of the present invention

[0070] According to the utilization example 1, the detection kit (gene sequencing method) was used to detect the peripheral blood of 45 cases of patients who had been treated with warfarin and had been detected by the liquid-phase chip method. Experiments show that the sensitivity, specificity and sensitivity of this kit are more accurate than the liquid chip method, and fully meet the practical requirements of current clinical diagnosis and treatment:

[0071] Table 2 Comparison of VKORC1 and CYP2C9 gene polymorphisms detected by two methods

[0072]

[0073] in:

[0074] (1) Specificity: 100%;

[0075] (2) Sensitivity: 100%;

[0076] (3) Positive predictive value: the positive predictive value reaches 100%;

[0077] (4) Negative predictive value: the negative predictive value reaches 100%;

[0078] (5) Repeatability: The results of repeated experiments are consistent;

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for quickly detecting polymorphism of VKORC1 and CYP2C9 genes. The kit is used for guiding the dosage of clinical warfarin. The kit comprises three pairs of primers shown as SEQ ID No.1-6, and can also further comprise one or more of the following reagents: polymerase chain reaction (PCR) reaction liquid, negative control, positive control, PCR sequencing reaction liquid and human peripheral blood genome extraction reagent. The kit is used for detecting the polymorphism of the VKORC1 and CYP2C9 genes by adopting a gene sequencing method with relatively high sensitivity and specificity, the specificity and the sensitivity of the detection result of the kit are remarkably improved, and the kit provides a brand-new, quick, simple and convenient gene diagnosis technology for clinically improving the safety and the validity of warfarin application.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a kit for detecting VKORC1 and CYP2C9 gene polymorphisms by using gene sequencing technology, and then guiding warfarin to select dosage. Background technique [0002] Warfarin is a coumarin drug that inhibits the synthesis of vitamin K-dependent coagulation factors and prolongs the activation time of prothrombin to achieve the purpose of anticoagulation. It is often used clinically to treat thrombotic diseases, and has dual functions of anticoagulation and thrombolysis. It is currently the most commonly used long-acting anticoagulant in the world, and it is also one of the main drugs for the treatment and prevention of venous thrombotic diseases. However, the effective blood concentration range of warfarin is narrow, and a small dose will reduce the effect of treating thrombosis, while a large dose will increase the risk of bleeding, and even cause side effects such as massive bleed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 李艳童永清
Owner 李艳
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com