Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pichia pastoris engineering bacteria of surface display candida antarctica lipase B (CALB) and method for catalyzing and synthesizing short-chain aromatic ester

A Pichia pastoris, surface display technology, which is applied in the field of whole-cell enzyme preparations to efficiently catalyze the synthesis of short-chain aromatic esters, can solve the problems of high cost, long production cycle, shortened reaction cycle, etc., and achieves short reaction time and reduced production cost. , the effect of high yield

Active Publication Date: 2010-08-04
SOUTH CHINA UNIV OF TECH
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Chinese invention patent CN1223300 discloses a method of microbial lipase enzymatic synthesis of ester, the enzyme used is the self-produced Rhizopus sinica lipase or commercial immobilized enzyme Lypozyme IM lipase, the catalytic reaction time is as long as 10-36h, The production cycle is long and the cost is high, shortening the reaction cycle and reducing the cost of enzyme preparation is an urgent need to promote the industrialization of short-chain aromatic ester enzymatic production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Production of a Pichia pastoris whole-cell enzyme preparation surface-displaying Candida antarctica lipase B.

[0027] First, primers were designed according to the nucleotide sequence of Candida antarctica lipase (calb) gene LF058 (the upstream primer is 5'TGTAGAATTCCTGCCTTCCGGTTCGGACCCTG 3', the EcoR I restriction site was introduced, and the downstream primer 5'GAGGCCGTAGCAGTGGGGATGCGCATAGAGCTCAGGTCCTCCACGAG 3' was introduced into Mlu I restriction site). The full-length calb was amplified by PCR using the genomic DNA of Candida antarctica as a template. The PCR program was as follows: pre-denaturation at 95°C for 5 min, 30 cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min, and extension at 72°C for 10 min.

[0028] Secondly, primers were designed according to the nucleotide sequence of α-lectin. The upstream primer was 5'CTCCGGCATCGTCACCCCTACGCGTATCTCGAGTCCAGGAGGTGCTC 3', which introduced the 19bp downstream end of the CALB gene and the MluI restriction s...

Embodiment 2

[0032] Using acetic acid and ethanol as substrates, a whole-cell enzyme preparation catalyzes non-aqueous phase esterification to prepare ethyl acetate.

[0033] Reagents are pre-used Molecular sieves fully remove water. Add absolute ethanol and glacial acetic acid to n-heptane. After adding, the concentration of absolute ethanol is 0.5mol / L, and the concentration of glacial acetic acid is 0.4mol / L. Take 10 mL of the substrate (288.6 μL of glacial acetic acid, 291.2 μL of absolute ethanol, 9420.2 μL of n-heptane, and the acid-alcohol molar ratio is 1:1.25) mixture in a 50 mL Erlenmeyer flask with a stopper, and add 30 g / L of Example 1 Prepare the lyophilized powder of bacteria, the reaction temperature is 40°C, and then shake the reaction at 200rpm, add 0.6g molecular sieve after 0.5h, react for 3h, the conversion rate of acetic acid can reach 92.1%, and the reaction time is only the report of the close yield 1 / 26 of.

Embodiment 3

[0035] Using butyric acid and isoamyl alcohol as substrates, whole-cell enzyme preparation catalyzed non-aqueous phase esterification to prepare isoamyl butyrate.

[0036] Reagents are pre-used Molecular sieves fully remove water. Add isoamyl alcohol and butyric acid to n-heptane. After the addition, the concentration of isoamyl alcohol was 0.88 mol / L, and the concentration of butyric acid was 0.8 mol / L. Take 10mL of substrate (734.3 μL of butyric acid, 957.7 μL of isoamyl alcohol, 8308 μL of n-heptane, and the acid-alcohol molar ratio is 1:1.1) mixture in a 50 mL Erlenmeyer flask with a stopper, and add 20 g / L of Example 1 Prepared thalline freeze-dried powder, reaction temperature 50 DEG C, shake reaction under 200rpm then, add 0.6g molecular sieve after 0.5h, react 3h, the conversion rate of butyric acid can reach 97%, report with Yang Benhong (Yang Benhong. Non-water Compared with lipase-catalyzed synthesis of isoamyl butyrate. China Food Additives, 2005, 5: 74-79) Rhi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses Pichia pastoris engineering bacteria of surface display candida antarctica lipase B (CALB) and a method for catalyzing and synthesizing short-chain aromatic ester. The method comprises the following steps of: fermenting a bacterial strain shake flask of the Pichia pastoris engineering bacteria of the surface display CALB to gain thalli; freezing and drying in vacuum for above 24h to prepare a whole-cell enzyme preparation; carrying out esterification reaction to obtain a short-chain aromatic ester product by adopting short-chain acid and short-chain alcohol as raw materials, the whole-cell enzyme preparation as a catalyst and liquid which can dissolve the short-chain acid and the short-chain alcohol as a solvent, wherein the temperature of the esterification reaction is 20-60 DEG C, the consistency of the whole-cell enzyme preparation of a reactant in a reaction system is 10-40g / L, and the reaction time is 1-6h. Compared with the prior report, the method greatly shortens the reaction time, has a productive rate as high as 98 percent and high continuous operating stability, can recycle the whole-cell catalyst which is centrifugally recovered after the reaction and greatly reduce production cost.

Description

technical field [0001] The invention relates to a gene expression vector capable of displaying Candida antarctica lipase B on the surface of Pichia pastoris and a Pichia engineered bacterium displaying high-activity lipase, in particular to a whole-cell enzyme preparation Efficient catalytic synthesis of short-chain aromatic esters. Background technique [0002] Most of the short-chain aromatic esters have edible fruit flavor, such as ethyl caproate, ethyl propionate, ethyl butyrate, etc. These short-chain esters are not only important components of flavors and fragrances, but also used as major food additives in the food, beverage, and brewing industries. The annual output of ethyl caproate in my country alone reaches more than 2,000 tons, with an output value of hundreds of millions. Yuan. These ester flavors currently used in production are mainly synthesized by chemical methods in the presence of inorganic catalysts. The production process often involves high temperatur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12P7/62C12R1/84
CPCY02P20/584
Inventor 林影韩双艳金子黄登峰郑穗平
Owner SOUTH CHINA UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com