Fluorescent biosensing method for inhibiting and analyzing and detecting interaction between micromolecules and binding protein based on restrictive incision enzyme FokI
A technology of restriction endonucleases and binding proteins, which is applied in the field of fluorescent biosensing based on restriction enzyme FokI inhibition analysis to detect the interaction between small molecules and binding proteins, can solve the problem of low sensitivity and poor reliability of detection techniques, It cannot meet the problems of accurate and rapid detection, and achieves the effect of quick and easy operation and simple design
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0024] Example 1: Detection of Biotin Based on Restriction Enzyme FokI Inhibition Assay
[0025] 1) Cross-linking of intermediate amino-labeled oligonucleotide DNA strands and biotin
[0026] Weigh 6.1mg of biotin and dissolve in 2.5mL phosphate buffer solution (0.1M NaH 2 PO4, pH 7.4), then add 1mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), stir at room temperature for 15min, then add 2.8mg of N-hydroxysuccinyl Imine (NHS), react at room temperature for 30min. Take 260 μl of the activated biotin solution and add it to 260 μl of 10 μM intermediate amino-labeled oligonucleotide DNA single strand (GAACAACAACCAACATCCAAACTTCTATATGGATGAAT(NH2)CAAC) solution, and react at room temperature for 2 h under gentle stirring. After the reaction, 3.6 mg of hydroxylamine hydrochloride was added to the mixed solution to terminate the reaction.
[0027] Transfer the cross-linked reaction product to a 1 mL dialysis tube with a molecular weight cut-off of 6000D. Put the dialysi...
Embodiment 2
[0030] Example 2: Detection of folate-binding proteins based on restriction enzyme inhibition assays
[0031] 1) Cross-linking of intermediate amino-labeled oligonucleotide DNA single strands and folic acid
[0032]Weigh 10mg of folic acid and dissolve in 2.5mL phosphate buffer solution (0.1M NaH 2 PO4, pH 7.4), then add 1mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), stir at room temperature for 15min, then add 2.8mg of N-hydroxysuccinate Imide (NHS), react 30mm at room temperature. Take 260 μl of the activated folic acid solution and add it to 260 μl of 10 μM intermediate amino-labeled oligonucleotide DNA single strand (GAACAACAACCAACATCCAAACTTCTATATGGATGAAT(NH2)CAAC) solution, and react at room temperature for 2 hours under gentle stirring. After the reaction, 3.6 mg of hydroxylamine hydrochloride was added to the mixed solution to terminate the reaction.
[0033] Transfer the cross-linked reaction product to a 1 mL dialysis tube with a molecular weight cut-...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com