Method for preparing micro-ecological preparation and application thereof
A technology of microecological preparations and hydrogen sulfide, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve the problems of weak hydrogen sulfide production ability and cannot be used as microecological preparations, and achieve the effect of extensive health care
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1-1
[0045] (1) Take rat liver tissue, after homogenization, extract total RNA by conventional methods of molecular biology;
[0046] (2) PCR primers for synthesizing cystathionine γ-lyase (CSE), the forward primer is 5'-ATGCCTCGAGATGCAGAAGGACGCCTCTTTGAG-3', and the reverse primer is 5'-ATGCATGCGCGGCCGCTTAAGGGTGCGCTGCCTTCAA-3';
[0047] (3) Using the total RNA extracted in (1) as a template, using the cystathionine γ-lyase primer synthesized in (2), carry out reverse transcription polymerase chain reaction (RT-PCR) with a reverse transcription kit. The reaction product was electrophoresed in 1% agarose gel, and the band with a size of about 1200bp was cut, and recovered with a gel-tapping recovery kit;
[0048] (4) Digest the PCR purified product in (3) with Xho| and Not| double enzymes, mix it with the yeast-Escherichia coli shuttle plasmid pGAPZ that has been digested by the same enzyme, connect it under the action of ligase, and transform it into Escherichia coli DH5α In strain...
Embodiment 1-2
[0052] (1) Take mouse pancreas tissue, after homogenization, extract total RNA with conventional methods (kit) of molecular biology;
[0053] (2) PCR primers for synthesizing cystathionine β-synthetase (CBS), the forward primer is 5'CGCATGCATCGTCCCCAGCATGCAGAAGAA3', and the reverse primer is 5'-CGCCTCGAG-CAGTTATTCAGAAGGTCTGGCCC-3';
[0054] (3) Using the total RNA extracted in (1) as a template, and using the cystathionine β-synthetase primer synthesized in (2), perform reverse transcription polymerase chain reaction (RT-PCR). The reaction product was electrophoresed in 1% agarose gel, and the band of about 1700bp was cut, and recovered by tapping gel recovery kit;
[0055] (4) Digest the purified PCR product in (3) with Nsi| and Xho|, mix it with the same digested lactic acid bacteria expression plasmid pNICE:sec, connect it under the action of ligase, and transform it into Lactococcus lactis NZ9000 In the competent cells, positive clones were screened;
[0056] (5) Statica...
Embodiment 1-3
[0059] (1) Isolation and screening of hydrogen sulfide producing bacteria from the natural environment by conventional methods;
[0060] (2) extracting the total DNA of the hydrogen sulfide producing bacteria screened in (1) by freezing and thawing;
[0061] (3) Synthesize the 3' end and 5' end primers of cysteine desulfurase, the forward primer is: 5'-GCATTGAGCCATGGACGGAGTTTA-3', the reverse primer is: 5'-CCGATTAAAGCTTAGCCCATTCGA-3';
[0062] (4) Using the total bacterial DNA extracted in (2) as a template, and using the forward and reverse primers synthesized in (3), perform polymerase chain reaction. After the reaction product was electrophoresed in 1% agarose gel, the part with a size of about 1300bp was cut and recovered, and the purified PCR product was digested with Nco| and Hand III, and connected to the pET 28b+ expression vector;
[0063] (5) transforming the cloned vector into competent cells of Escherichia coli BL-21 strain with calcium chloride treatment, and s...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com