Human prostate specific antigen expression vector and application thereof
A prostate-specific, expression vector technology, applied in the field of genetic engineering, can solve the problems of reducing biological activity, lack of processing, modification, affecting the correct folding and glycosylation of PSA, and achieving the effects of reduced production cost and easy construction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1, Construction of human prostate-specific antigen Pichia pastoris expression vector pPIC9K-PSA
[0030] as attached figure 1 As shown, the construction steps of the expression vector pPIC9K-PSA:
[0031] 1. Cloning of PSA gene and construction of pMD18-simple-T-PSA vector
[0032] 1. Using the cDNA library purchased from Megaman as a template, use primers P1 and P2 to synthesize a gene with an EcoRI restriction site at the 5' end, a Not I restriction site at the 3' end and a His-tag coding sequence by PCR fragment.
[0033] Primer PI: 5'aaagaattcattgtgggaggctgggagtgcgagaa 3'
[0034] Primer P2: 5'tatgcggccgcatggtgatggtgatgatgggggttggccacgatggtgtcctt 3'PCR reaction system:
[0035] Sterile water 14μl
[0036] 10xExTaq Buffer 2.5μl
[0037] 10xMgCl 22.5μl
[0038] 2.5mM dNTP 2μl
[0039] 10mM P1-5'primer 1μl
[0040] 10mM P2-3'primer 1μl
[0041] ExTaq 0.125μl
[0042] Template 2μl
[0043] PCR cycle: 94°C for 5 minutes denaturation; 94°C for 30 seco...
Embodiment 2
[0053] Example 2. Screening and Induced Expression of Human Prostate Specific Antigen High Copy Strain
[0054] 1. Screening of high-copy positive transformant expression strains
[0055] 1. The pPIC9K-PSA obtained in Example 1 was linearized with Sal I endonuclease, and the linearized plasmid pPIC9K-PSA was obtained by ethanol precipitation.
[0056] 2. The linearized plasmid pPIC9K-PSA was electrotransformed into Pichia pastoris
[0057] 1) Streak Pichia pastoris GS115 on a YPD-plate and culture it at 30°C for 2-3 days to activate it. Pick a monoclonal colony and inoculate it in 50ml YPD liquid medium, and cultivate it to OD at 30°C 600 It is 1.3-1.5.
[0058] 2) Centrifuge the culture solution in step 1) at 3000 rpm at 4°C for 5 minutes to collect yeast cells, and discard the supernatant.
[0059] 3) Suspend the above yeast cell pellet with an equal volume of sterilized water, centrifuge at 3000 rpm at 4°C for 5 minutes to collect the yeast cells, and discard the supern...
Embodiment 3
[0079] Example 3, Separation and Purification of Human Prostate Specific Antigen
[0080] 1) The bacterial cell culture solution of Example 2 was centrifuged, and the expression supernatant was concentrated to 100 ml with PEG20000. In Balance Buffer (the composition is 137mM NaCl, 2.7mM KCl, 10mM NaCl 2 HPO 4 , 2mM KH 2 PO 4 , pH7.4) dialyzed.
[0081] 2) The dialyzed expression supernatant was passed through a High-Affinity Ni-NTA column (purchased from Jinsite Company). Equilibrate the chromatography column with 5 times the column volume of Balance Buffer in advance.
[0082] 3) After loading the sample, wash to the baseline with Balance Buffer, and then use 2 times the column volume of Elution Buffer (the composition is 137mM NaCl, 2.7mM KCl, 10mM NaCl 2 HPO 4 , 2mM KH 2 PO 4 , 250mM imidazole, pH7.4) eluted, and 5ml of the elution peak was collected.
[0083] 4) Take 2 μg of the purified protein sample, stain it with Coomassie brilliant blue after denatured 12% S...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap