Avid kyowamycin genetic engineering bacterium and use thereof
A technology of Streptomyces avermitilis and genetically engineered bacteria, which is applied in the field of microbial fermentation and genetic engineering, can solve the problems of low fermentation unit and high production cost, and achieve the effect of reducing production cost and increasing output
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Embodiment 1, the construction of frr gene expression vector
[0023] 1. Construction of recombinant plasmid containing frr gene and its own promoter
[0024] 1. Amplification of the frr gene containing its own promoter
[0025] Design primers for PCR amplification of the frr gene [NC_003155.4(3224362...3223805)] located on the chromosome of Streptomyces avermitilis with its own promoter, and the upstream primer PrimerF1 (CCGACATGACCGCGATCAC) is located 300bp upstream of the frr start codon , downstream primer Primer R1 (CG GAATTC GTCATGCGCATCGTACGTGG, the underlined base is the restriction endonuclease EcoRI recognition site) is located 150 bp downstream of the frr stop codon, and the amplified product should be 976 bp.
[0026] Using the total DNA of Streptomyces avermitilis wild-type strain ACTT31267 as a template, PrimerF1 and Primer R1 as primers, PCR amplification was carried out, and the amplification conditions were 95°C, 4min; (95°C, 1min; 60°C, 1min; 72°C, ...
Embodiment 2
[0035] Embodiment 2, transformation of recombinant plasmid
[0036] A total of four expression plasmid vectors of frr genes were constructed through Example 1, namely pFR1-1139, pFR1-152, pFR4-1139 and pFR4-152, and the original plasmids used as controls were pKC1139 and pSET152. The characteristics of these six plasmids are briefly described (Table 1).
[0037] Table 1 Characteristics of recombinant plasmids containing frr gene and original plasmids
[0038]
[0039] Due to the strong restriction modification in Streptomyces avermitilis, the transformation efficiency of Streptomyces avermitilis is very low when using the plasmid extracted from E.coliDH5α to directly transform Streptomyces avermitilis, sometimes even no transformant can be obtained. However, the transformation efficiency of the plasmid from E.coli ET12567, a recipient strain without restriction modification, was significantly improved. Therefore, the constructed recombinant plasmids and control plasmids w...
Embodiment 3
[0042] Embodiment 3, the fermentation research of transformant
[0043] 1. Fermentation research of ATCC31267 and its transformants
[0044] 1. Shake Flask Fermentation of Streptomyces avermitilis
[0045] Seed medium: 30g soluble starch, 2g malt extract, 2g soybean peptone, CoCl 2 ·6H 2 O 5mg, add distilled water to 1L, adjust pH to 7.0-7.2.
[0046] Fermentation medium: 50g soluble starch, 12g yeast powder, MgSO 4 ·7H 2 O 0.5g, K 2 HPO 4 ·3H 2 O 0.5g, KCl4g; CaCO 3 2g, CoCl 2 ·6H 2 O 5mg, add distilled water to 1L, adjust pH to 7.0-7.2.
[0047] Streptomyces avermitilis wild-type strain ATCC31267 and its different transformants grow abundant spores on the YMS medium and inoculate them in the seed medium (loading capacity is 100mL / 500mL Erlenmeyer flask), and cultivate them in a shaker at 28°C for 24 hours ( Speed 180rpm, eccentricity 2.5cm). Inoculate in the fermentation medium (loading capacity is 50mL / 300mL Erlenmeyer flask) by 5% inoculation amount, cultiv...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap