Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-obesity agent and Anti-obesity food

an anti-obesity food and agent technology, applied in the direction of peptides, drug compositions, metabolic disorders, etc., can solve the problems of adverse effects on the body, difficulty in exercising, and increase in the number of obese persons, so as to prevent obesity spontaneously and inhibit obesity

Inactive Publication Date: 2010-08-26
SCHOOL CORP AZABU VETERINARY MEDICINE EDUCATIONAL INSTITUTION +1
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0011]The anti-obesity agent and anti-obesity food and drink of the invention are able to prevent the absorption of a lipid from the intestinal tract by ingesting them while taking a normal meal. Since lactic acid bacteria are used from old in producing fermented foods such as yogurt and fermented milk and have extremely high safety, they can be ingested without anxiety.BEST MODES FOR CARRYING OUT THE INVENTION
[0079]Also, by incorporating genes encoding subunits of a glycerol-degrading enzyme or a gene encoding an enteroadherent protein, each of which has been found out from the lactic acid bacterium of the invention, into other lactic acid bacterium by a known measure, it becomes possible to obtain a lactic acid bacterium with high glycerol-degrading properties or a lactic acid bacterium with a long intestinal residence time. It is also possible to advantageously use it for the modification of other useful lactic acid bacteria.

Problems solved by technology

In the modern society, as the result of lack of exercise and meals with excessive calories, a neutral fat is accumulated in the body, and the number of persons who are judged to be obese continues to increase, resulting in a serious problem.
In order to prevent this obesity, though it is the best to perform exercise for consuming a fat to be ingested, it is actually difficult to perform exercise, and a reduction in the ingestion of a fat is demanded.
However, when it was intended to inhibit the obesity through unreasonable dietary restrictions, an intake of other necessary nutrients was insufficient, or the balance was upset, resulting in possibly adversely affecting the body.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-obesity agent and Anti-obesity food
  • Anti-obesity agent and Anti-obesity food

Examples

Experimental program
Comparison scheme
Effect test

example 1

Anti-obesity Effect Test of L. reuteri JCM1112T

[0050]An anti-obesity effect of L. reuteri JCM1112T was examined by the following materials and method.

Materials and Test Method:

(1) Experimental Animal:

[0051]Wistar rats of SPF grade (males of 8-week-old; Japan SLC, Inc.) having a body weight of from about 180 to 200 g were used, an acclimatization period of 7 days from the day for the sending in a laboratory was provided, and the experiment was then started. The breeding circumstance was set up at a temperature of 22±1° C., a humidity of 55±5% and a lighting time of 12 hours (from 8:00 to 20:00); and the rats were caged individually and provided with free access to sterile distilled water through a watering bottle and a radiation-sterilized solid diet* for rat (CE-2, CLEA Japan, Inc.) by a feeder, respectively. All of the breeding instruments to be used were ones sterilized by a high-pressure steam sterilizer.

[0052]*: Use for breeding and propagation (crude fat: 4.6%)

(2) Preparation o...

example 2

Genome Analysis of L. reuteri JCM1112T

[0058]DNA was obtained from L. reuteri JCM1112T by using the following chemicals in the following method, thereby achieving genome analysis.

Method for Obtaining DNA:

(Chemicals)

[0059]Nuclei Lysis solution (Wizard genome DNA purification kit; manufactured by Promega)[0060]Physiological saline[0061]50 mM EDTA (pH: 7.0)[0062]50 mg / mL lysozyme solution (prepared on the day by dissolving a prescribed amount of lysozyme in a TE buffer solution, 0.25 M Tris-HCl (pH 8.0) or 10 mM Tris-HCl (pH 8.0) / 10 mM EDTA / 0.5% SDS)[0063]2 mg / mL EDTA[0064]Phenol / chloroform / isoamyl alcohol (25:24:1) mixed solution (hereinafter abbreviated as “PCI”)[0065]Chloroform / isoamyl alcohol (24:1) mixed solution (hereinafter abbreviated as “CIA”)[0066]99% Ethanol[0067]70% Ethanol[0068]TE buffer solution

(Method)

[0069]1. L. reuteri JCM1112T is cultured at 37° C. for 24 hours under static conditions, and the obtained culture solution (50 mL) is centrifuged at 3,500 r.p.m. for 15 minu...

example 3

Amplification of Glycerol-degrading Gene

[0074]PCR was carried out by using DNA as purified in Example 2 as a template and the following nucleotide sequences as primers and using the following reaction solutions. The PCR condition is also shown below.

(Primer)pduCDE(F):CACCATGAAACGTCAAAAACGATTTpduCDE(R):AAAAGCTTAGTTATCGCCCTTTAGC

(PCR reaction solution)Template DNA: 1 μLKOD-plus: 1 μL10 × KOD-plus buffer solution: 5 μLdNTP (2 mM each): 5 μLPrimer (20 mm): 1 μL eachMgSO4 (25 mm): 2 μLDeionized water (D.W.):34 μL

(PCR Condition)

[0075](1) To hold at 94° C. for 3 minutes.

(2) To hold at 94° C. for 15 seconds.

(3) To hold at 56° C. (Tm) for 30 seconds.

(4) To hold at 68° C. for 3 minutes 30 seconds.

(5) To perform (2) to (4) in 30 cycles.

(6) To preserve at 4° C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
pHaaaaaaaaaa
body weightaaaaaaaaaa
Login to View More

Abstract

An anti-obesity agent containing, as an active ingredient, a microorganism which belongs to the species Lactobacillus reuteri and is capable of producing lipases having the amino acid sequences respectively depicted in SEQ ID NO: 1, 3 or 5 or amino acid sequences having deletion, substitution or addition of one or more amino acids in the amino acid sequences respectively depicted in SEQ ID NO: 1, 3 or 5. The anti-obesity agent enables a patient to take a normal meal yet preventing the absorption of a fat into the body which is the primary cause of obesity.

Description

TECHNICAL FIELD[0001]The present invention relates to an anti-obesity agent and an anti-obesity food, and in more detail, the invention relates to an anti-obesity agent and an anti-obesity food each capable of inhibiting a lipid from being taken from a digestive tract to prevent obesity from occurring.BACKGROUND ART[0002]The obesity is a disease in a weight control system which is characterized by an excess of body fat. In the modern society, as the result of lack of exercise and meals with excessive calories, a neutral fat is accumulated in the body, and the number of persons who are judged to be obese continues to increase, resulting in a serious problem.[0003]In order to prevent this obesity, though it is the best to perform exercise for consuming a fat to be ingested, it is actually difficult to perform exercise, and a reduction in the ingestion of a fat is demanded.[0004]However, when it was intended to inhibit the obesity through unreasonable dietary restrictions, an intake of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N1/20C07H21/04C07K14/335C12N9/00C12N9/06C12N9/12C12N9/04C12N9/90A23L33/00A23L33/10A23L33/135A23L33/20C12N15/09
CPCA23V2002/00A61K35/747A61K48/00C07K14/335C12N9/0006C12N9/0008C12N9/1205C12N9/20C12N9/90A23L33/135A61P3/04C12R2001/225C12N1/205A23V2200/3204A23V2200/332A23V2400/173A61K35/74A61K38/46
Inventor MORITA, HIDETOSHIMASAOKA, TOSHIOSUZUKI, TAKEHITO
Owner SCHOOL CORP AZABU VETERINARY MEDICINE EDUCATIONAL INSTITUTION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com