Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Process for preparing cytosine suanine dinuleotide sequence molecule immunopotentiator

An immune enhancer and dinucleotide technology, applied in the field of molecular immune enhancer preparation, can solve the problems of severe side effects of animals, incomplete and unsustainable immune protection of vaccines, etc., to enhance immune effect, ensure sustainable and healthy development, Boost your immune system

Inactive Publication Date: 2004-12-15
AGRI BIO TECH INST GUANGDONG ACADEMY OF AGRI SCI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, aluminum salt adjuvant has its obvious disadvantages, that is, it cannot induce Th1 response, interfere with cellular immunity, and block the activation of CD8+CTL, making the immune protection of the vaccine incomplete and not durable
Complete Freund's adjuvant (CFA) can cause Th1 response to inoculated antigens and induce effective cellular and humoral immunity, but it has not been approved for use in humans due to its serious side effects. During animal immunization, it has relatively large side effects on animals , causing an emergency response

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] A kind of preparation method of cytosine guanine dinucleotide sequence molecular immunopotentiator of the present invention, its embodiment is as follows:

[0021] The sequence of the CpG DNA fragment used is:

[0022] 5’ TCCATGACGTTCCTGACGTT 3’

[0023] (Germany HMG Biotech GmbH company)

[0024] The CpG DNA fragment can be cloned into the pUC18 plasmid by using the conventional genetic engineering technology in the "Molecular Cloning Experiment Guide" to obtain a recombinant plasmid containing the CpG DNA fragment.

[0025] Then use the CaCl in the "Molecular Cloning Experiment Guide" 2 The transformation method introduces the plasmid into bacteria, which is a genetically engineered bacterium containing CpGDNA fragments.

[0026] The above-mentioned engineered bacteria were cultured overnight with LB medium whose components were 10g / l peptone, 5g / l sodium chloride and 5g / l yeast extract, and then collected 10ml of bacterium liquid. Resuspend with 0.5 ml of a solut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The preparation process includes introducing CpG sequence plasmid into bacteria for expression to form engineering bacteria containing CpG sequence plasmid, culturing the said engineering bacteria, and alkali cracking to extract plasmid DNA to prepare CpG molecular immunopotentiator. The CpG molecular immunopotentiator of the present invention can strengthen the immunological effect of deactivated and attenuated vaccine, the immunological effect of engineering vaccine, and especially the immunological effect of all spectrum DNA vaccine, and may be used in animal husbandry.

Description

technical field [0001] The invention relates to a preparation method of a molecular immune enhancer, in particular to a preparation method of a molecular immune enhancer containing a cytosine guanine dinucleotide (CpG) sequence plasmid. Background technique [0002] my country is the second largest producer of meat products in the world, with an annual output of more than 60 million tons and an annual per capita consumption of more than 50Kg. In 2002, the number of live pigs sold in China exceeded 600 million, and that in Guangdong Province exceeded 32 million. Exports account for less than 3 percent of production due to drug residues and poor quality. With the strengthening of green trade barriers in developed countries, my country's livestock and poultry product market will face more intense competition, and "green" products will become the direction of demand. In order to reduce the occurrence of livestock and poultry diseases, and to avoid the negative effects of bacte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/7084A61P37/04C12N15/63
Inventor 田兴山张玲华邝哲师陈薇李健雄
Owner AGRI BIO TECH INST GUANGDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com