Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Human recombinant herpes simplex virus for producing slow virus vector

A herpes simplex virus and lentiviral vector technology, applied in the field of biotechnology invention, can solve the problem of low titer of the vector

Inactive Publication Date: 2004-03-17
AGTC GENE TECH CO LTD
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current general method is still co-transfection of multiple (2-4) plasmids, so the vector titer is low, and it can produce recombinant replicable vectors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human recombinant herpes simplex virus for producing slow virus vector
  • Human recombinant herpes simplex virus for producing slow virus vector
  • Human recombinant herpes simplex virus for producing slow virus vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Construction of cos6-VSVG

[0046] The VSV-G expression cassette (CMV promoter / beta-globin enhancer+VSV-G+beta-globin polyA) in the plasmid pLP / VSVG (Invitrogen) was called out by PCR (about 3770bp in length), and the primers were: Upstream 5'TCTAGACTTGGCCCATTGCATA 3'; Downstream 5'TCTAGAACTGCCATGTCGAGGG 3'. Both ends are XbaI sites. The reaction conditions are: 94°C, 30"; 56°C, 30"; 72°C, 4'. The PCR product was digested with XbaI and loaded into the XbaI site of cos6 to obtain the cosmid cos6-VSVG.

Embodiment 2

[0047] Example 2 Construction of cos56-gag / pol

[0048] The gag / pol expression cassette (CMV promoter / beta-globin enhancer+gag / pol+RRE+beta-globin polyA) in the plasmid pLP1 (Invitrogen) was called out by PCR (about 6837bp in length), and the primers were: Upstream 5' TCTAGATTGGCCCATTGCATAC 3'; Downstream 5' TCTAGAACTGCCATGTCGAGGG 3'. Both ends are XbaI sites. The reaction conditions are: 94°C, 30"; 56°C, 30"; 72°C, 7'. The PCR product was digested with XbaI and loaded into the XbaI site of cos56 to obtain the cosmid cos56-gag / pol.

Embodiment 3

[0049] Example 3 Construction of cos6-rev

[0050] The Rev expression cassette (RSV promoter+Rev+HIV polyA) in plasmid pLP2 (Invitrogen) was called out by PCR (about 971bp in length), and the primers were: upstream 5'TCTAGACAATGTAGTCTTATGC 3'; downstream 5'TCTAGACCAGGGTTTTCCTGAT3'. Both ends are XbaI sites. The reaction conditions are: 94°C, 30"; 56°C, 30"; 72°C, 1'. After the PCR product was digested with XbaI, it was loaded into the XbaI site of cos6 to obtain the cosmid cos6-rev.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention describes one kind of recombinant human herpes simplex virus-1, named HSV1-Lenti-helper virus, and its genome has inserted various trans protein expressing cassettes, such as gag, pol, VSV-G, Rev, etc. needed for packing slow virus carrier. Infecting carrier cell strain with the recombinant HSV virus can express gag, pol, VSV-G, Rev and other protein in high level, and thiscan save slow virus carrier genome existing in provirus form in the carrier cell strain chromosome to pack slow virus carrier. By means of affinity chromatography, ion adsorption chromatography, hyperfiltration separation or other method, the slow virus carrier may be separated from HSV to reach the aim of purification. The method features the virus infection mode, rather than plasmid transfection mode, in producing slow virus carrier with high carrier titer, low cost and adaptability for large-scale production.

Description

technical field [0001] The present invention belongs to the field of biotechnology inventions. It specifically relates to the construction and use of a group of recombinant human herpes simplex virus type 1 (Herpes Simplex Virus type 1, HSV1) "recombinant HSV1-Lenti-helper virus" mainly used for the preparation of lentiviral vectors. Background technique [0002] About retroviruses: Retroviral vectors are widely used in the field of gene therapy and gene transfer. It can introduce foreign aid genes into somatic cells including mice, primates and humans, and integrate them into In the cell genome, the purpose of long-term stable expression is achieved, so that it has very good prospects for application in many fields including genetic disease treatment, transplantation, stem cell transduction and so on. [0003] Retroviruses are RNA viruses with DNA intermediates in their life cycle. Retroviral particles contain two identical RNA molecules, the viral core protein contains e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N15/867C12N15/869
CPCC12N15/86C12N2740/15043C12N2710/16644C12N2740/15022C12N2740/15052
Inventor 吴小兵董小岩曹晖侯云德
Owner AGTC GENE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com