Human recombinant herpes simplex virus for producing slow virus vector
A herpes simplex virus and lentiviral vector technology, applied in the field of biotechnology invention, can solve the problem of low titer of the vector
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1 Construction of cos6-VSVG
[0046] The VSV-G expression cassette (CMV promoter / beta-globin enhancer+VSV-G+beta-globin polyA) in the plasmid pLP / VSVG (Invitrogen) was called out by PCR (about 3770bp in length), and the primers were: Upstream 5'TCTAGACTTGGCCCATTGCATA 3'; Downstream 5'TCTAGAACTGCCATGTCGAGGG 3'. Both ends are XbaI sites. The reaction conditions are: 94°C, 30"; 56°C, 30"; 72°C, 4'. The PCR product was digested with XbaI and loaded into the XbaI site of cos6 to obtain the cosmid cos6-VSVG.
Embodiment 2
[0047] Example 2 Construction of cos56-gag / pol
[0048] The gag / pol expression cassette (CMV promoter / beta-globin enhancer+gag / pol+RRE+beta-globin polyA) in the plasmid pLP1 (Invitrogen) was called out by PCR (about 6837bp in length), and the primers were: Upstream 5' TCTAGATTGGCCCATTGCATAC 3'; Downstream 5' TCTAGAACTGCCATGTCGAGGG 3'. Both ends are XbaI sites. The reaction conditions are: 94°C, 30"; 56°C, 30"; 72°C, 7'. The PCR product was digested with XbaI and loaded into the XbaI site of cos56 to obtain the cosmid cos56-gag / pol.
Embodiment 3
[0049] Example 3 Construction of cos6-rev
[0050] The Rev expression cassette (RSV promoter+Rev+HIV polyA) in plasmid pLP2 (Invitrogen) was called out by PCR (about 971bp in length), and the primers were: upstream 5'TCTAGACAATGTAGTCTTATGC 3'; downstream 5'TCTAGACCAGGGTTTTCCTGAT3'. Both ends are XbaI sites. The reaction conditions are: 94°C, 30"; 56°C, 30"; 72°C, 1'. After the PCR product was digested with XbaI, it was loaded into the XbaI site of cos6 to obtain the cosmid cos6-rev.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap