Method for preparing interferon
An interferon and fermentation test technology, applied in the field of preparing α1b type interferon, can solve the problems of low expression level, incorrect expression amount, low fermentation density, etc., and achieves the effects of improved expression level, simplified method and good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1 Alteration of Partial Sequence of Human α1b-type Interferon Gene
[0018] For the codon optimization of the coding gene in Escherichia coli, and the secondary structure of the expression plasmid TIR, the following changes were made, and at least one site of the mutation site was changed to produce the same effect. 1) Perform synonymous mutations on the nucleotide sequence encoding the 12th, 13th, 14th, and 15th amino acids of the N-terminal of α1b interferon, and the nucleotide sequences are changed from AGG, AGG, ACC, TTG to CGT, CGT, ACT, CTG.
[0019] The mutated α1b interferon gene was correct after the complete sequence analysis, and it was named α1bM. The synthetic primer: 5'CCAGGAGCATCAGAGTACGACGGTTATCCAGGC3' was phosphorylated with T4 polynucleotide kinase according to the conventional method in this field, and the 12th, 13th, 14th, and 15th positions of the N-terminal Amino acid nucleotides were site-specifically changed, and the above-mentioned muta...
Embodiment 2
[0022] Example 2 Construction of α1bM2 gene interferon expression plasmid and its expression
[0023] 1) Prokaryotic expression plasmid expressing α1b interferon from T7 promoter
[0024] The α1bM2 gene PCR product was digested with NdeI and BamHI, inserted into the PET plasmid with T7 promoter digested by NdeI and BamHI, and transformed into Escherichia coli DH5α. It was proved by enzyme digestion that the α1bM2 gene had been inserted into the PET plasmid, and the plasmid was named pEAM2.
[0025] 2) The expression plasmid is expressed in Escherichia coli
[0026] Known engineered bacteria
[0027]
Embodiment 3
[0028] Example 3 High-density fermentation and purification of engineering bacteria in a fermenter
[0029] Large-scale fermentation: pick a single colony into the LB medium containing 50 μg / ml kanamycin, shake and cultivate overnight at 37°C, transfer to 6000ml LB medium containing 50μg / ml, shake and culture at 37°C for 4 hours until OD600 to 0.6 Transfer to a 300L fermenter with 150L fermentation medium, set certain conditions, and add nutrients. When the culture reaches OD600 to about 10, add lactose to induce culture for 6 hours, and collect the bacteria by centrifugation. SDS-PAGE electrophoresis scanning proves that the expression of interferon accounts for 30% of the soluble bacteria, which is more than 10 times higher than that of the original strain in the same volume of fermentation.
[0030] The fermentation medium contains (gram / liter): KH 2 PO 4 0.5-2.5,K 2 HPO 4 ·3H 2 O0.5-2.5, MgSO4 ·7H 2 O2.0-5.0, (NH 4 ) 2 SO 4 0.5-3.0, Yeast extract2.0-6.04, PPE0.15 ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap