Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific protein of SARS virus, clinical detection method and kit

A technology of pneumonia virus and detection method, applied in the field of human medical and health, to achieve the effect of high accuracy and accurate diagnosis method and kit

Inactive Publication Date: 2005-08-31
BEIJING BGI GBI BIOTECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is currently no effective immunochemical detection method for the virus, and it can only be diagnosed based on clinical symptoms (high fever, dry cough, shadows in lung X-ray detection, etc.), which are greatly limited and can only be made after the onset of the infection. Diagnosis, and not easy to distinguish from other pneumonia and common influenza

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific protein of SARS virus, clinical detection method and kit
  • Specific protein of SARS virus, clinical detection method and kit
  • Specific protein of SARS virus, clinical detection method and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1. Preparation of protein:

[0035] A. Design corresponding PCR primers, and add bases corresponding to the corresponding number of amino acid residues to the PCR primers used. One of the primers is as follows: AlL: CGGGATCCGAACTTTAAAATCTGTGTAGC AlR: CCGCTCGAGATTTCTGCAACCAGCTCAAC

[0036] Extract RNA and amplify the DNA fragments encoding the above proteins from clinical atypical pneumonia virus standard strains respectively; the method of extracting RNA can adopt the method introduced in the general molecular biology experiment manual, such as "molecular cloning", or use commercial reagents box, such as Trizol R , according to the instructions, then add reverse primer and reverse transcriptase to synthesize cDNA; use commercial kits, such as Invitrogen TM The company's SuperScript kit synthesizes cDNA according to the instructions; then PCR technology is used to amplify the DNA fragments encoding the above proteins. The composition of the PCR reaction system is a gen...

Embodiment 2

[0053] Example 2, Double Antigen Sandwich Method for Detection of SARS Antibody

[0054] Add the coating solution diluted with 0.02M pH9.6 carbonate buffer (CB) to the optimum concentration in advance on the 96-well microwell reaction plate, let stand at 4°C for 24 hours, add 0.1% TW-20 0.02M pH7.4 PBS washing solution (PBS-T) was added to each well, discarded after standing for a few seconds, and washed twice. Add 200 μl of 0.02M pH7.4 phosphate buffer saline (PBS) with 1% bovine serum albumin (BSA) and 1% skim milk powder to each well, and block for 2 hours at 4°C. Discard the blocking solution, dry at room temperature, seal the plate with an aluminum thin bag, and store at 4°C until use. Add the enzyme-labeled antigen corresponding to the SARS coronavirus antigen diluted with the optimized concentration in advance with the enzyme-labeled antigen diluent (20% goat serum, 1% casein, 0.02MPBS, pH7.4) in the well of the microwell reaction plate, 50 μl per well, then add 15 se...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a SARS virus specific protein, its clinical detection method and kit. Said invention provides the SARS virus specific protein or its fragment or derivative with immunological activity of conjugated human immunoglobulin, and the method for making immunodetection of SARS virus by utilizing said general formula protein and its kit. Said invention has high accuracy for detecting SARS virus.

Description

technical field [0001] The invention relates to the field of human medicine and health, in particular to a specific protein of atypical pneumonia virus and a method and kit for clinical detection. Background technique [0002] SARS virus is a virus that causes severe acute respiratory syndrome (Severe Acute Respiratory Syndrome, SARS), also known as atypical pneumonia. , 737 nucleotides. When the infection is serious, it can cause death, and the case fatality rate is as high as 4.9%. It is mainly transmitted through close-range air droplets and close contact. There is currently no effective immunochemical detection method for the virus, and it can only be diagnosed based on clinical symptoms (high fever, dry cough, shadows in lung X-ray detection, etc.), which are greatly limited and can only be made after the onset of the infection. Diagnosis, and not easy to distinguish from other pneumonia and common influenza. According to the genome sequenc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/165C07K16/08C07K19/00C12Q1/68G01N33/52G01N33/531G01N33/569G01N33/577G01N33/68
Inventor 汪建方健秋文洁牟峰陈唯军刘斯奇胡咏武殷剑宁王俊杨焕明
Owner BEIJING BGI GBI BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com