Specific protein of SARS virus, clinical detection method and kit
A technology of pneumonia virus and detection method, applied in the field of human medical and health, to achieve the effect of high accuracy and accurate diagnosis method and kit
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] 1. Preparation of protein:
[0035] A. Design corresponding PCR primers, and add bases corresponding to the corresponding number of amino acid residues to the PCR primers used. One of the primers is as follows: AlL: CGGGATCCGAACTTTAAAATCTGTGTAGC AlR: CCGCTCGAGATTTCTGCAACCAGCTCAAC
[0036] Extract RNA and amplify the DNA fragments encoding the above proteins from clinical atypical pneumonia virus standard strains respectively; the method of extracting RNA can adopt the method introduced in the general molecular biology experiment manual, such as "molecular cloning", or use commercial reagents box, such as Trizol R , according to the instructions, then add reverse primer and reverse transcriptase to synthesize cDNA; use commercial kits, such as Invitrogen TM The company's SuperScript kit synthesizes cDNA according to the instructions; then PCR technology is used to amplify the DNA fragments encoding the above proteins. The composition of the PCR reaction system is a gen...
Embodiment 2
[0053] Example 2, Double Antigen Sandwich Method for Detection of SARS Antibody
[0054] Add the coating solution diluted with 0.02M pH9.6 carbonate buffer (CB) to the optimum concentration in advance on the 96-well microwell reaction plate, let stand at 4°C for 24 hours, add 0.1% TW-20 0.02M pH7.4 PBS washing solution (PBS-T) was added to each well, discarded after standing for a few seconds, and washed twice. Add 200 μl of 0.02M pH7.4 phosphate buffer saline (PBS) with 1% bovine serum albumin (BSA) and 1% skim milk powder to each well, and block for 2 hours at 4°C. Discard the blocking solution, dry at room temperature, seal the plate with an aluminum thin bag, and store at 4°C until use. Add the enzyme-labeled antigen corresponding to the SARS coronavirus antigen diluted with the optimized concentration in advance with the enzyme-labeled antigen diluent (20% goat serum, 1% casein, 0.02MPBS, pH7.4) in the well of the microwell reaction plate, 50 μl per well, then add 15 se...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com