Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction and fermentation method of artificial strain with high yield of fengycin

A high-yield strain and fermentation method technology, which is applied in the construction and fermentation field of Fengyuansu high-yield artificial strains

Active Publication Date: 2021-08-20
TIANJIN UNIV
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the effect of fatty acids on the synthesis of Fengyuan has not yet been studied. Therefore, increasing the synthesis of intracellular fatty acids is of great significance for increasing the production of Fengyuan.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and fermentation method of artificial strain with high yield of fengycin
  • Construction and fermentation method of artificial strain with high yield of fengycin
  • Construction and fermentation method of artificial strain with high yield of fengycin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Construction of Fengyuansu synthetic strain B.subtilis ds

[0036] (1) Design and synthesis of primers for sfp gene amplification. According to the nucleic acid sequence of the sfp gene (as shown in SEQ ID NO: 1), the amplification primers were designed as follows (the underlined straight line indicates the SalI restriction site, and the underlined wavy line indicates the BglII restriction site). Technology Co., Ltd. for synthesis.

[0037] SFP-F:AA GGCCAA CGAGGCCCAAAAAGAAGAACGGACACAGCGGTTC

[0038] SFP-R:

[0039]

[0040] (2) Extraction of the genome of Bacillus amyloliquefaciens FZB42. Take 3-5mL of bacterial liquid cultured in LB liquid medium at 37°C and 220rpm / min for 12-16h, centrifuge at 4°C and 12000rpm for 30s, and collect the precipitate. Add 500 μL of cell lysate to the precipitation, shake it upside down 7-8 times, and keep it in a 37°C metal bath for 30 minutes. Add 264 μL of 5M NaCl solution to the above lysate, shake it upside down 7-8...

Embodiment 2

[0058] Example 2: Construction of B.subtilis dspabacd, a high-yielding strain of Fengyuansu

[0059] (1) According to the nucleic acid sequence of the promoter P43 (as shown in SEQ ID NO: 3), the nucleic acid sequence of the acetyl-CoA synthetase gene acs (as shown in SEQ ID NO: 4), the acetyl-CoA carboxylase gene accACD The nucleotide sequence (as shown in SEQ ID NO: 6) and the nucleotide sequence (as shown in SEQ ID NO: 5) of the biotin ligase gene birA were entrusted to Qingke Biotechnology Co., Ltd. to synthesize acs, birA, accACD and P43 in series fusion fragment, and connected into the expression vector pHT43, the construction process is as follows Figure 5 As shown, the recombinant expression plasmid pHTABPC carrying birA gene, acs gene, accACD gene and P43 promoter was obtained.

[0060](2) The expression plasmid pHTABPC was introduced into B. subtilis ds by means of transformation, spread on a chloramphenicol screening pressure plate for solid plate culture, and cul...

Embodiment 3

[0061] Embodiment three: the cultivation and fermentation of B.subtilis ds and B.subtilis dspabacd

[0062] (1) Culture medium composition:

[0063] Seed medium: tryptone 10g / L, yeast extract powder 5g / L, NaCl 10g / L, pH 7.0;

[0064] Fermentation medium: xylose 20g / L, water-soluble soybean cake powder 21.9g / L, NaNO 3 3.1g / L, MnSO 4 ·H 2 0.2g / L, pH 7.5.

[0065] (2) Cultivation and fermentation of B. subtilis ds and B. subtilis dspabacd. The fengyuansu synthetic strain B.subtilis ds and the fengyuansu high-yielding bacterial strain B.subtilis dspabacd of the present invention were respectively cultured on solid plates, cultured upside down at 37°C for 13-17 hours, single colonies were taken, and continued to be cultured on solid plates , cultured upside down at 37°C for 24 hours, took a single colony, and carried out seed culture in 50mL liquid medium, cultivated at 37°C and 220rpm / min for 12h to obtain seed liquid, and inoculated with a volume ratio of 5% Inoculate a la...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction and fermentation method of an artificial strain with high yield of fengycin. The 4'-phosphoric acid pantetheinyl transferase gene sfp from bacillus amyloliquefaciens FZB42, a multi-effect factor gene degQ from bacillus subtilis 168 and a strong promoter P43 are integrated in series onto a genome of the bacillus subtilis 168 by utilizing CRISPR gene editing to construct a strain B.subtilis ds; an acetyl coenzyme A synthetase gene acs of Escherichia coli BL21, an acetyl coenzyme A carboxylase gene accACD of Salmonella enterica and a biotin ligase gene bisA of Corynebacterium glutamicum are connected in series to an expression vector pHT43, and the expression vector pHT43 is introduced into a fengycin synthesis strain B.subtilis ds, so that a fengycin high-yield strain B.subtilis dspabacd is constructed; the constructed engineering strain is fermented and cultured in a shake flask to produce the fengycin.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and relates to the serial integration of the 4'-phosphopantetheinyl transferase gene sfp regulatory factor gene degQ into the genome of Bacillus subtilis 168, and the overexpression of the acyl-CoA synthetase gene acs, Biotin ligase gene birA and acetyl-CoA carboxylase gene accACD, a method for constructing a high-yield Fengyuansu strain. Background technique [0002] Fengyuan element (fengycin) is synthesized by Bacillus through non-ribosomal peptide synthesis pathway. It is composed of a β-hydroxy fatty acid chain containing 16 to 18 carbon atoms and ten amino acid residues. The factor can have a good inhibitory effect on filamentous fungi. So far, the mechanism of the inhibitory effect of the factor on the fungus is still inconclusive. At present, the theory accepted by the academic circle is that the factor interacts with the phospholipid bilayer of the cell. It penetrates the phospho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/75C12N15/52C12N15/54C12N15/31C12P21/02C07K7/06C12R1/125
CPCC12N15/75C12N15/52C12N9/1288C12N9/93C07K14/32C12Y207/08007C12Y604/01002C12Y602/01003C12Y603/04014C12P21/02C07K7/06Y02E50/10
Inventor 闻建平谭维银莹
Owner TIANJIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com