A kit for detecting Drosophila spotted wing based on terrestrial environment DNA and its application
A spotted-winged Drosophila and a kit technology, applied in the field of agricultural biology, can solve the problems that the identification and monitoring are difficult to eliminate the influence of interfering factors, the technicians cannot make very objective judgments, the detection object is single, etc., and the detection efficiency and timeliness are achieved. The effect of good performance and simple detection process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044]A kit for detecting terrestrial Drosophila spotted wing based on environmental DNA, including primer pairs and Taqman fluorescent probes designed according to the gene of the target pest Drosophila spotted wing;
[0045] The selected Drosophila spotted wing specific DNA sequence is shown in SEQ ID NO.1, which is derived from the difference sequence between the Drosophila spotted wing genome and the genome of similar species, and the specific sequence is:
[0046] GGAAAGTCGTCGCCAAAGTTGCCGTCACATGTTGCACTTCTCCAGCCCGCCATAATTGCTCCTAATTGAAATGCGAAACCCGCAACAAAACTGAACCGAAATGCCAGC
[0047] Primer pairs included BCGY4-F and BCGY4-R.
[0048] The DNA sequence of BCGY4-F is shown in SEQ ID NO.2, specifically: GGAAAGTCGTCGCCAAAGTT.
[0049] The DNA sequence of BCGY4-R is shown in SEQ ID NO.3; specifically: GCTGGCATTTCGGTTCAGTT.
[0050] The DNA sequence of the Taqman fluorescent probe is shown in SEQ ID NO.4, specifically: CACATGTTGCACTTCTCAGCCCGCCATAA.
Embodiment 2
[0052] A method for detecting Drosophila spotted wing content in the terrestrial environment of the kit of embodiment 1, specifically:
[0053] (1) Establish a standard curve for Drosophila spotted wing:
[0054] 1.1. Use the TSINGKE Animal Genomic DNA Kit to extract 50 μL of the genomic DNA of Drosophila spotted wing adults two days after eclosion, and measure its concentration by an ultraviolet spectrophotometer to be 156.0 ng / μL.
[0055] 1.2. Using deionized water, the genomic DNA of Drosophila spotted wing was diluted to 10 times according to a 10-fold gradient. -1 、10 -2 、10 -3 、10 -4 times liquid. The stock solution and the above dilution were used as standard sample templates for Real-time qPCR reactions, and two sets of biological replicates were performed.
[0056] Table 1 qPCR reaction system
[0057]
[0058] Table 2 qPCR reaction program
[0059]
[0060] 1.3. Two standard curves with close Cq values in each standard sample group were obtained in tw...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap