Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction of African swine fever gene-deleted attenuated strain and application of African swine fever gene-deleted attenuated strain as vaccine

An African swine fever virus and gene deletion technology, which is applied in the field of construction of African swine fever gene deletion attenuated strains, can solve the problems of low virus titer, reduced immunogenicity or protective effect, and residues of attenuated strains

Active Publication Date: 2021-07-23
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the prior art, the virulence gene knockout vaccine of classical swine fever virus still has the following problems: ① Different strains have different effects of deleting the same gene, and if the deletion is not sufficient, there will be residual virulence and pathogenicity, and multiple gene deletions cause The low titer of the virus will also reduce the risk of immunogenicity or protective effect of the attenuated strain; ②Whether the knockout virulence gene reduces virus transmission and detoxification is an important indicator of biosafety, and it is best to obtain an immune clearance vaccine Candidate strains to reduce the risk of detoxification and detoxification; ③Although the whole genome sequencing of African swine fever has been completed, there are more than 160 regulatory genes and structural genes that make up the African swine fever virus. Although the functions of all genes are studied It is a huge project, but a comprehensive study of the function of each regulatory gene and structural gene is crucial for its pathogenic mechanism and vaccine development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of African swine fever gene-deleted attenuated strain and application of African swine fever gene-deleted attenuated strain as vaccine
  • Construction of African swine fever gene-deleted attenuated strain and application of African swine fever gene-deleted attenuated strain as vaccine
  • Construction of African swine fever gene-deleted attenuated strain and application of African swine fever gene-deleted attenuated strain as vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1 Construction, purification and identification of recombinant virus Δ181 / UK

[0073] 1. CRISPR / Cas9 vector construction

[0074] (1) Optimization of pX330 vector: Since African swine fever virus mainly replicates in the cytoplasmic virus factory, pX330 was first optimized when constructing the pCRISPR / Cas9 vector; the nucleus at both ends of the Cas9 enzyme was removed by ClonExpress II one-step cloning method. Localization Signal (NLS), named pX330ΔN.

[0075] (2) MGF360-18R gene, DP71L gene and DP96R gene are adjacent genes, design targeting gRNAs for DP71L and DP96R genes, their oligonucleotide names and sequences are: 181 / UK-gRNA-L:GCTCCTCCACGCTCGCGATCCGG( SEQ ID NO. 8); 181 / UK-gRNA-R: TTACAGGAAGAATAATGG GGAGG (SEQ ID NO. 9).

[0076] (3) Referring to the cloning method recommended by the literature (Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genomeengineering using the CRISPR-Cas9 system. Nat Protoc. 2013; 8(11):2281-2308) , the oligonucle...

Embodiment 2

[0085] Example 2 Determination of virus titer

[0086] The titer of African swine fever virus is expressed by half the hemocytosis (50% haemadsorption, HAD50). For the specific operation of the HAD50 experiment, see the literature (Borca MV, Ramirez-Medina E, Silva E, Vuono E, Rai A, Pruitt S, Holinka LG, Velazquez-Salinas L, Zhu J, Gladue DP. Development of a highly effective Afri can swine fever virus vaccine by deletion of the I177Lgene results in sterile immunity aga inst the current epidemic Eurasiastrain. JVirol.2020.pii:JVI.02017-19) , while making appropriate adjustments: in a 96-well plate by about 1x10 5 Inoculate primary PAM cells per well of cells, serially dilute the recombinant virus to be tested by 10-fold gradient, a total of 7 dilutions, 8 wells at each dilution, add 100 μL / well of the diluted virus to PAM in a 96-well plate, and then add For red blood cells, a total of three replicates were performed. Virus infection can be judged according to the garland f...

Embodiment 3

[0087] Example 3 Toxicity evaluation of gene deletion strain Δ181 / UK

[0088] In order to detect the virulence of the gene deletion strain Δ181 / UK, this experiment used 10 4 HAD 50 Doses were administered intramuscularly to assess virulence in pigs.

[0089] In this experiment, 13 healthy landrace piglets negative for African swine fever antigen and antibody were used and divided into 3 groups. Among them, 5 were challenged with parental strain A SFV CN / GS / 2018 isolate and 5 in gene deletion strain Δ181 / UK group. The three experimental pigs were the cohabitation controls of the Δ181 / UK inoculated group. The changes in body temperature were measured every day after the inoculation, and peripheral blood and saliva were collected. Bastos AD, DrewTW.20 03.Development of a TaqMan PCR assay with internal amplificationcontrol for the detectioni on of African swine fever virus.J Virol Methods 107:53-61), determination of ASFV virus content in blood by fluorescent quantitative PCR me...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a gene-deleted attenuated African swine fever virus strain capable of being used as a vaccine and a construction method of the gene-deleted attenuated African swine fever virus strain. The virus strain is a gene-deleted attenuated strain of a parent African swine fever virus (ASFV) CN / GS / 2018 isolated strain. The invention finds that the DP71L gene is a new target gene for attenuating swine pathogenicity, and finds that the functions of coding proteins of the MGF360-18R gene, the DP71L gene and the DP96R gene are jointly lost, so that the toxicity of a parent strain is reduced, and a high-safety attenuated African swine fever candidate vaccine strain is obtained; after pigs are immunized by the attenuated African swine fever candidate vaccine strain with high dose (104HAD50), the attenuated African swine fever candidate vaccine strain is completely attenuated, the immunized pigs are healthy and free from diseases, nucleic acid of pigs living together with the immunized pigs is negative and is not spread horizontally, and the attenuated African swine fever candidate vaccine strain has relatively good safety; 100% immune protection can be provided for attacking the ASFV CN / GS / 2018 virulent strain, and the vaccine can be used as a candidate vaccine for safely and effectively preventing and controlling the African swine fever epidemic situation and has great social value.

Description

[0001] This application claims the priority of an earlier application with an application date of July 10, 2020, an application number of CN202010661680.7, and the title of the invention "Construction of African Swine Fever Gene Deletion Attenuated Strain and Its Application as a Vaccine". The entire contents of the previous application have been reflected in this application. technical field [0002] The invention belongs to the technical field of bioengineering, and in particular relates to the construction of an African swine fever gene-deficient attenuated strain with MGF360-18R gene, DP71L gene and DP96R gene encoding protein function loss and its application as a vaccine. Background technique [0003] African Swine Fever (ASF) is an acute and severe infectious disease caused by African Swine Fever Virus (ASFV) infection, characterized by fever and hemorrhage of pigs' systemic organs. The fatality rate for domestic pigs is as high as 100%. . The disease first broke out...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/34C07K14/01C12N7/01C12N15/85C12N15/90A61K39/12A61P31/20C12R1/93
CPCC07K14/005C12N7/00C12N15/85C12N15/902A61K39/12A61P31/20C12N2710/12022C12N2710/12021C12N2710/12034C12N2710/12052C12N2800/107A61K2039/5254A61K2039/552
Inventor 郑海学李攀冯涛齐晓兰刘华南张克山李丹吴盼雪马昭党文刘迎琦石正旺杨波田宏郭建宏刘湘涛
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com