Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mouse model for knocking out miRNA-125a based on CRISPR/Cas9 technology and construction method

A miRNA-125a and mouse model technology, applied in the field of genetic engineering, can solve the problems of less miRNAs fragment knockout, knockout of C57BL/6J mice, and none

Inactive Publication Date: 2021-06-22
国家卫生健康委科学技术研究所
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Generally speaking, compared with coding genes, there are few studies on miRNAs fragment knockout based on CRISPR / Cas9 technology; in particular, there is no C57BL / 6J gene that knocks out miRNA-125a based on CRISPR / Cas9 technology. Related reports on the construction method of mice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mouse model for knocking out miRNA-125a based on CRISPR/Cas9 technology and construction method
  • Mouse model for knocking out miRNA-125a based on CRISPR/Cas9 technology and construction method
  • Mouse model for knocking out miRNA-125a based on CRISPR/Cas9 technology and construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Design sgRNA

[0054] Sequences were analyzed for suitable sgRNAs, using the website (http: / / crispr.mit.edu) to analyze available sequences in mouse pre-miRNA-125a. Two sgRNAs (SEQ ID NO:1, 2) were selected as fragment knockouts, as follows:

[0055] The sequence of SEQ ID NO:1 is (sgRNA1): CTCACAGGTTAAAGGGTCTC(5'→3')

[0056] The sequence of SEQ ID NO:2 is (sgRNA2): GGGTCACAGGTGAGGTTCTT(5'→3')

[0057] According to the above two sgRNAs, design the target sequence with linker and its complementary sequence, as follows: SEQ ID NO:3 sequence is (sgRNA1-F): gtttgCTCACAGGTTAAAGGGTCTC(5'→3')

[0058] The sequence of SEQ ID NO:4 is (sgRNA1-R): aaacGAGACCCCTTTAACCTGTGAGc(5'→3')

[0059] The sequence of SEQ ID NO:5 is (sgRNA2-F): gtttGGGTCACAGGTGAGGTTCTT(5'→3')

[0060] The sequence of SEQ ID NO:6 is (sgRNA2-R): aaacAAGAACCTCACCTGTGACCC (5'→3')

Embodiment 2

[0061] Example 2 Construction of expression vector

[0062] a) Plasmid linearization

[0063] Digest the lentiCRISPR V2 vector according to the system shown in Table 1:

[0064] Table 1 enzyme digestion system

[0065]

[0066] Digest overnight at 37°C, add loading buffer to a final concentration of not less than 1×, purify the digested product by 0.8% agarose gel electrophoresis, and recover the linear DNA band by cutting the gel. The steps for gel recovery are as follows (commercialized by Omega Corporation) Reagent test kit):

[0067] 1. Cut out the target DNA band in the agarose gel, add an equal volume of gel solution GSB, and put it in a metal bath at 65°C for 5-10 minutes to completely dissolve it.

[0068] 2. Add all the glue solution to the spin column in batches and let it stand for 1min, centrifuge at 12000rpm for 1min, and discard the effluent.

[0069] 3. Add 300 μL GSB to wash the spin column, centrifuge at 12000 rpm for 1 min, and discard the effluent.

...

Embodiment 3

[0105] Embodiment 3 sgRNA activity verification

[0106] 1) Routinely culture mouse liver AML12 cells, spread 12-well plates, and transfect the constructed LentiCRISPR V2 vector when the confluence is about 80%, transfect 1.5 μg of plasmid per well.

[0107] 2) Prepare a complete medium containing 2 μg / mL puromycin (puro). After 24 hours of transfection, change to the selection medium containing puro, and continue to culture normally for 48 hours; at this time, it can be observed that the cells in the control wells without transfection plasmid gradually die, and continue to culture with the normal complete medium until the cells are basically confluent. The genomic DNA of the cells can be extracted, and the target fragment containing the sgRNA target region is amplified by PCR, and the PCR primers are designed as F: 5'-GAGCTGGGGTGTCTTCTCTG-3' (SEQ ID NO: 7), R: 5'-CAGCAGGAACAACAGGACAA-3' ( SEQ ID NO: 8). The PCR amplification system is shown in Table 4.

[0108] Table 4 PCR...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mouse model for knocking out miRNA-125a based on a CRISPR / Cas9 technology and a construction method. The mouse model for knocking out the miRNA-125a based on the CRISPR / Cas9 technology is characterized in that the CRISPR / Cas9 technology is utilized to knock out a genome fragment of pre-miRNA-125a in a C57BL / 6J mouse. The construction method comprises the steps of designing a pair of sgRNAs for fragment knockout in a mouse genome, transcribing the two sgRNAs in vitro, co-injecting the transcribed sgRNAs and Cas9 nuclease into a fertilized egg of the C57BL / 6J mouse, and transferring the fertilized egg into a parent to develop into a primary (F0) mouse; and identifying and purifying the F0 mouse to obtain a homozygous individual of which the fragment is knocked out. The expression quantity of the miRNA-125a in a homozygous knockout mouse is obviously reduced. The invention provides a method for accurately, efficiently, simply and conveniently knocking out the miRNA-125a, the construction method can be used for the mouse model for miRNA-125a function research, and also has a reference value for realizing the fragment knockout of other miRNAs.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and more specifically relates to a mouse model and a construction method for knocking out miRNA-125a based on CRISPR / Cas9 technology. Background technique [0002] Gene site-specific modification technology is one of the important means to study gene function. Following the early gene targeting, researchers have discovered three generations of artificial endonucleases. The third-generation artificial endonuclease Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / CRISPR-associated (Cas) has been widely used because of its simple operation, low cost and high efficiency[1]. Among them, CRISPR / Cas9 is the most widely used gene editing tool so far. It consists of an RNA chain chimerized together with crRNA and tracrRNA——sgRNA (singleguide RNA) and Cas9 protein. Cas9 protein is an endonuclease, including two active centers of RuvC and HNH, which can cut one strand of DNA u...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01K67/027C12N15/89C12N9/22C12N15/113C12Q1/6888
CPCA01K67/0276C12N15/89C12N9/22C12N15/113C12Q1/6888A01K2227/105A01K2217/15A01K2267/03C12Q2600/124C12N2310/20
Inventor 王瑚夏红飞马旭管纯一张璐
Owner 国家卫生健康委科学技术研究所
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com