Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Full-length infectious clone of attenuated vesicular stomatitis virus mutant and application of full-length infectious clone

A technology of infectious cloning and vesicular stomatitis, applied in the direction of virus/bacteriophage, application, virus, etc., can solve the problems of limited popularization and application, high toxicity of normal cells, and killing of cells in brain regions

Pending Publication Date: 2020-11-24
INNOVATION ACAD FOR PRECISION MEASUREMENT SCI & TECH CAS
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, vesicular stomatitis virus has a wide range of cell tropism and has been widely used in the field of oncolytic virus and vaccine development. However, it also has defects such as high toxicity to normal cells and trans-synaptic killing of cells in other brain regions, which limits its use. Extended application in neuroscience, oncolytic virus and vaccine development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Full-length infectious clone of attenuated vesicular stomatitis virus mutant and application of full-length infectious clone
  • Full-length infectious clone of attenuated vesicular stomatitis virus mutant and application of full-length infectious clone
  • Full-length infectious clone of attenuated vesicular stomatitis virus mutant and application of full-length infectious clone

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The full-length infectious clone of attenuated vesicular stomatitis virus mutant carrying green fluorescent gene is constructed, and its construction method is as follows:

[0029] PVSV-Venus(addgeneNo.: 36399) used XhoI and MscI to double-cut the vector, and pVSV-EGFP-dG(addgeneNo.: 31842) used XhoI and MscI to double-cut the EGFP. The two were ligated by T4 ligase, and the ligation product was transformed into competent Stbl3. The positive clone identified by PCR was cultured and the plasmid was extracted for sequencing. The clone with correct sequencing was named PVSV-. The full-length infectious clone plasmid pVSV-EGFP of VSV was used as the template to amplify the N1 fragment with Takara PrimerstarPolymerase, and the primers were N1-F (ATCATTGAACACACACACGTTCATT) and N1-R (GTATATTACAATGTCAGGCTGTCGGGCATT). The amplified DNA fragments are detected and recovered in a conventional way; The N2(R7A) fragment was amplified by using the N1 fragment as the template, and the prim...

Embodiment 2

[0035] PVSV-N(R7A)-△M51-EGFP successfully prepared VSV expressing green fluorescence, which comprises the following steps:

[0036] The core plasmid of pVSV-N(R7A)-△M51-EGFP virus genome was co-transfected with packaging plasmids PBS-N, PBS-P and PBS-L (in the mass ratio of 6:6:2:1). BHK-21 cells treated by poxvirus expressing T7 RNA polymerase for 1 hour were treated at 35℃ and 5% (v / v). 2 Culture in an incubator, remove the supernatant after 6 hours, replace it with 2ml of fresh DMEM medium containing 5% fetal bovine serum, and place it in a 5% (v / v) CO2 incubator at 31℃ for further culture. After 24 hours, observe the cell state and fluorescence expression by inverted fluorescence microscope (Olympus), collect the supernatant after 120 hours, filter it with a 0.1μm filter to remove the pox virus and infect the normal BHK-. Using blue excitation fluorescence, obvious green fluorescence signal can be seen ( Figure 1B), indicating that the recombinant virus was successfully rescue...

Embodiment 3

[0038] The application of recombinant VSV prepared by pVSV-N(R7A)-△M51-EGFP at the cellular level includes the following steps:

[0039] BHK-21 cells were inoculated in a 12-well plate for culture. When the cell density was 70% ~ 80%, pVSV-EGFP (hereinafter referred to as WT-VSV, Lin et al. Molecular Brain (2020) 13: 45) and pVSV-N(R7A)-EGFP were inoculated respectively according to the multiplicity of infection (MOI) of 3. Lin et al. Molecular Brain (2020) 13: 45) and pVSV-N(R7A)-△M51-EGFP (hereinafter referred to as VSV-N(R7A)-△M51) viruses were incubated, and then cultured at 35℃ for 72 hours. After observing the cell morphology and fluorescence signal, we found that WT-VSS Figure 2 A)； Furthermore, we subcultured the cells infected with VSV-N(R7A)-△M51, and found that the infected cells could grow normally and express green fluorescence ( Figure 2 B)。 The above data indicate that the mutant VSV-N(R7A)-△M51 virus has lower cytotoxicity, and can be used to transduce the target g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a full-length infectious clone of an attenuated vesicular stomatitis virus mutant and an application of the full-length infectious clone. The full-length infectious clone successfully prepares the recombinant vesicular stomatitis virus mutant carrying green fluorescent protein, has the characteristics of being capable of being replicated and proliferated and low in cytotoxicity and avoiding cross-synaptic transmission in the brain, can be used as a transfer vector to transduce target genes to express at the cell level, and can also be used for studying cranial nerve circuits.

Description

Technical field [0001] The invention belong to that field of biotechnology, and particularly relates to a full-length infectious clone of an attenuated vesicular stomatitis virus mutant and application thereof. technical background [0002] Virus vector is one of the important gene transfer vectors, which plays an increasingly important role in brain science research, disease treatment, tumor treatment and vaccine development. Vesicular stomatitis virus (VSV), belonging to Vesiculovirus of Rhabdoviridae, is a single-stranded negative-strand RNA virus with envelope. The length of the gene is about 11-12kb, and five non-overlapping genes, N, P, M, G and L, are arranged in sequence from 3 ′ to 5 ′, which respectively encode nucleoprotein N, phosphoprotein P, matrix protein M, glycoprotein G and macropolymerase protein L. There is an untranslated leader of 47 nucleotides at the 3' end of the N gene and a 59-nucleotide trailor at the 5' end of the L gene. The genes of vesicular stomat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/47C12N7/01C12N15/65
CPCC07K14/005C12N7/00C12N15/65C12N2760/20221C12N2760/20222
Inventor 林坤章徐富强
Owner INNOVATION ACAD FOR PRECISION MEASUREMENT SCI & TECH CAS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com