Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Trehalose synthesis bifunctional enzyme coding gene TvTPS/TPP and application thereof

A bifunctional enzyme and coding gene technology, applied in the field of microorganisms, can solve the problems affecting the survival of Trichoderma, affecting the agricultural control effect and industrial production capacity, etc., and achieve the effect of improving the application effect.

Active Publication Date: 2020-11-17
BIOLOGY INST OF SHANDONG ACAD OF SCI +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In production, preservation, transportation, and industrial and agricultural applications, Trichoderma will inevitably face some adverse effects in the natural environment and fermentation environment, such as high temperature, low temperature, salinity, drought, etc., which directly affect the survival of Trichoderma, and then Affect its agricultural control effect and industrial production capacity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trehalose synthesis bifunctional enzyme coding gene TvTPS/TPP and application thereof
  • Trehalose synthesis bifunctional enzyme coding gene TvTPS/TPP and application thereof
  • Trehalose synthesis bifunctional enzyme coding gene TvTPS/TPP and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] Embodiment 1: the cloning of Trichoderma viride TvTPS / TPP gene sequence and the construction of expression vector

[0072] (1) Cloning of TvGCN5 gene expression cassette

[0073] Genomic DNA of Trichoderma viride Tv-1511 was extracted according to the instructions of the fungal genome extraction kit (E.Z.N.A Fungal DNA Kit, OMEGA, USA).

[0074] Using genomic DNA as a template to amplify the complete sequence of the TvTPS / TPP gene expression cassette, the amplification primers are: TvTPS / TPP-FL-EcoRI-F: CGGAATTCATGGCGCGTTATGAGTCTCCTCT (SEQ ID NO.3) and TvTPS / TPP-FL-KpnI -R: GGGGTACCTCCACAACTCCTCCTCCGGAATGT (SEQ ID NO. 4).

[0075] Use the high-fidelity PCR polymerase master mix (2×Phanta Master Mix, Nanjing Nuoweizan) to carry out PCR amplification to obtain the TvTPS / TPP gene expression cassette with enzyme-cleaved junction sites (EcoRI and KpnI); 1% agarose gel electrophoresis to obtain a 2625bp DNA fragment ( figure 2 ); use the DNA recovery kit (FastPure Gel DNA...

Embodiment 2

[0083] Example 2: Protoplast preparation and construction of overexpressed engineered bacteria

[0084] (1) Protoplast preparation

[0085] Trichoderma viride Tv-1511 was inoculated on a PDA plate, and after culturing at 28°C for 10 days, a large amount of fresh conidia were produced; with 10mL of normal saline (0.9% NaCl, 0.05% Tween-20), the mycelial surface was washed, filtered through glass wool paper, Removing the mycelia to obtain a spore suspension;

[0086] Spread 200 μL of the spore suspension on a cellophane-covered PDA plate, and incubate at 28°C in the dark for 24 hours to germinate the spores on the PDA plate;

[0087] Preparation of lysing enzyme solution: Take 0.15 g of lysing enzyme (Lysing enzyme, Sigma: L1412) and dissolve it in 20 mL of solution I (1.2M D-sorbitol, 0.1M KH 2 PO 4 ,pH 5.6), 0.2μM membrane filter sterilization;

[0088] Take out the PDA plate, take out the fiber membrane with mycelia and stick it on the plate containing 3-4mL lysate, and t...

Embodiment 3

[0098] Embodiment 3: Analysis of Trichoderma viride original strain and TvTPS / TPP-OE engineered bacteria salt tolerance

[0099] Collection of sterile spores

[0100] Inoculate the original strain of Trichoderma viride and TvTPS / TPP-OE engineering bacteria on the PDA plate, and after cultivating for 10 days at 28°C, a large amount of fresh conidia were produced; the surface of the mycelia was washed with 10mL normal saline (0.9%NaCl, 0.05%Tween), and after Filter with glass wool paper, remove mycelia to obtain spore suspension; suspend with 30% glycerin, mix thoroughly, dispense into 1.5mL centrifuge tubes, mark the name and time, and freeze at -80°C; take a tube of spores Count the viable bacteria in the solution to determine the concentration of the spore solution.

[0101] Plate salt tolerance test

[0102] Activate the original strain of Trichoderma (Wildtype) and TvTPS / TPP-OE engineering bacteria on the PDA plate first, and culture them in the dark at 28°C for 48-72 hou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a trehalose synthesis bifunctional enzyme coding gene TvTPS / TPP and application thereof, and belongs to the technical field of microorganisms. The trehalose synthesis bifunctional enzyme coding gene TvTPS / TPP is identified from Trichoderma viride Tv-1511, and protein coded by the gene contains structural domains of TPS and TPP and has double functions. Trichoderma engineering bacteria overexpressed by TvTPS / TPP are constructed by using an expression vector and homologous recombination, the content of trehalose in the Trichoderma engineering bacteria is increased, the obtained Trichoderma engineering bacteria overexpressed by the TvTPS / TPP gene has higher stress tolerance, the ability of Trichoderma strains to resist the natural environment and the adverse growth environment in industrial fermentation can be enhanced, and the application of Trichoderma viride in agricultural and industrial production is promoted.

Description

technical field [0001] The invention belongs to the technical field of microbes, and in particular relates to a coding gene TvTPS / TPP for a trehalose-synthesizing bifunctional enzyme and an application thereof. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] Trichoderma (Trichoderma spp.) is an important class of multifunctional filamentous fungi. It is an important enzyme production strain in industry, and it is also an important biocontrol strain and plant growth-promoting strain in agricultural production. It has a wide range of applications in biological control, cellulase production and biomass utilization. [0004] In production, preservation, transportation, and i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54C12N15/80C12N1/15C12R1/885
CPCC12N9/1051C12N15/80C12Y204/01015C12Y204/01216
Inventor 李哲郭凯张豪隋永辉黄艳华郝永任
Owner BIOLOGY INST OF SHANDONG ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More