Application of ccdc157 gene and its mutant gene as molecular markers in the diagnosis of male infertility
A technology of CCDC157 and CCDC157-MIF515, which is applied in the fields of biomedicine and gene mutation diagnosis, and can solve the problems of unclear biological functions and related molecular mechanisms
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Screening of patients with CCDC157-MIF515 mutation gene in patients with asthenozoospermia and their semen analysis
[0027] 1) This study was approved by the Ethics Committee of the Obstetrics and Gynecology Hospital Affiliated to Zhejiang University School of Medicine and informed consent was obtained from the patients. The semen of 50 patients with asthenozoospermia was collected in the Obstetrics and Gynecology Hospital Affiliated to Zhejiang University School of Medicine, and patients with organic lesions of the reproductive system, untreated endocrine disorders, drug or alcohol abuse within two years, chromosome, and AZF abnormalities were excluded Patients with semen abnormalities due to known causes such as , cryptorchidism, or mumps.
[0028] Asthenospermia patients masturbated to extract sperm, and used TIANamp Micro DNA Kit to extract the patient's semen DNA (according to the sixth item of the instruction manual - extraction of genomic DNA from micr...
Embodiment 2
[0040] Embodiment 2, the acquisition of CCDC157 knockout mice
[0041] 1) Using CRISPR / Cas9 technology, design 2 sgRNA sequences targeting the CCDC157 gene (the number in the NCBI database is 216516) through the CRISPR online website (http: / / crispr.mit.edu). The design strategy is as follows figure 2 As shown in A, gRNA1 (SEQ ID NO.12): CTCTGAGAGCGGCCTATGGTGGG; gRNA2 (SEQ ID NO.13): GGGAGGATCCATCCAACCTAGGG (both gRNAs are antisense strands of matching genes). After synthesis and annealing, it was connected to the pX458 vector expressing Cas9 protein.
[0042] 2) The pX458 vector was transferred into embryonic stem cells, which were screened by flow cytometry and then transferred to culture dishes for 24 hours. After the culture was completed, single clone selection and genotype identification were carried out.
[0043] 3) Mate C57BL / 6N female mice that were superovulated by hormone treatment with wild-type male mice in advance to obtain a large number of blastocyst cells (s...
Embodiment 3
[0060] Example 3 CCDC157 Gene Knockout Causes Infertility in Male Mice
[0061] 1) Observe and count CCDC157 - / - Mice and CCDC157 + / + growth and development of mice. The results showed that CCDC157 - / - Mice with CCDC157 + / + Survival rate of mice, appearance (such as figure 2 F) and no difference in overall behavior; male CCDC157 - / - Mice are completely sterile, female CCDC157 - / -The fertility of the mice was not affected. The above results indicate that CCDC157 knockout mice cause male sterility.
[0062] 2) Take 3 male CCDC157 - / - Mice were mated with several female wild-type mice for 3 months. During mating, the reproductive tract of female wild-type mice was observed for the presence of sperm plugs. The results were as follows: there were sperm plugs in the genital tract of female wild-type mice, which indicated that the mating was normal; but no offspring were born.
[0063] The above results indicated that CCDC157 gene knockout affected the fertilization proce...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com