Phytase mutant
A mutant, acid enzyme technology, applied in the direction of enzyme, hydrolase, plant gene improvement, etc., can solve the problems of high phosphorus feces polluting the environment, waste of phosphorus source, poor thermal stability, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0209] Example 1 Screening of heat-resistant mutants
[0210] The amino acid sequence of the wild-type phytase APPA derived from Escherichia coli is SEQ ID NO: 1, and its coding nucleotide sequence is SEQ ID NO: 2. In order to improve the heat resistance of phytase APPA, the applicant analyzed the protein structure of its gene. The protein has two structural domains: 134 amino acid residues at the N-terminus and 152 amino acid residues at the C-terminus together form domain 1, The remaining 124 amino acid residues in the middle constitute domain 2, and the conserved sequence and active center are located in domain 1. On the premise of not destroying the protein secondary structure and active center, the gene is further mutated.
[0211] 1.1 Design PCR primers APPA-F1, APPA-R1:
[0212] APPA-F1: GGC GAATTC CAGTCAGAACCAGAGTTGAAGTT (the underline is the restriction endonuclease EcoRI recognition site), as shown in SEQ ID NO: 3;
[0213] APPA-R1: ATA GCGGCCGC TTACAAGGAACAA...
Embodiment 2
[0240] Example 2 Expression of phytase mutants in Pichia pastoris
[0241] According to the coding preference of Pichia pastoris, the APPA gene sequence SEQ ID NO: 2 and the mutant gene sequence were optimized and synthesized, and EcoRI and NotI were added to the 5' and 3' ends of the synthetic sequence respectively. cut site.
[0242] 2.1 Construction of expression vector
[0243] The gene sequences of the synthesized APPA and the mutant were digested with EcoRI and NotI respectively, and then ligated with the pPIC-9K vector after the same digestion at 16°C overnight, and transformed into Escherichia coli DH5a, spread on the LB+Amp plate, Inverted culture at 37°C, after transformants appeared, colony PCR (reaction system: template-picked single clone, rTaqDNA polymerase 0.5ul, 10×Buffer 2.0μL, dNTPs (2.5mM) 2.0μL, 5'AOX primer (10M ): 0.5 μL, 3’AOX Primer: 0.5 μL, ddH 2 O14.5μL, reaction program: 95°C pre-denaturation for 5min, 30 cycles: 94°C 30sec, 55°C 30sec, 72°C 2min,...
Embodiment 3
[0261] Embodiment 3 Expression of phytase mutant in Trichoderma reesei
[0262] According to the codon preference of Trichoderma, the APPA gene sequence SEQ ID NO: 2 and the mutant gene sequence were optimized and synthesized, and KpnI and MluI were added to the 5' and 3' ends of the synthetic sequence respectively. Restriction sites.
[0263] 3.1 Construction of expression vector
[0264] The synthesized phytase gene fragment and pSC1G vector were digested with restriction endonucleases KpnI and MluI (Fermentas) respectively, and the digested products were purified using a gel purification kit, and separated with T4 DNA ligase (Fermentas). The above phytase gene was ligated with the digested product of pSC1G vector and transformed into Escherichia coli Trans5α (Transgen), selected with ampicillin, and the clone was verified by sequencing (Invitrogen). After the sequencing is correct, a recombinant plasmid containing the phytase gene is obtained.
[0265] 3.2 Construction o...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com