Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

bcl2 mutant capable of promoting large gene expression and its application

A gene expression and mutant technology, applied in the field of genetic engineering, can solve the problems of low expression, affect recombinant protein, and insignificant expression effect, and achieve the effect of promoting expression

Active Publication Date: 2021-06-01
HANGZHOU DIANZI UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for genes with a relatively large target recombinant protein gene (greater than 4.3kb, such as coagulation factor VIII gene), the expression level is relatively low due to unstable mRNA, which affects the industrial production of recombinant proteins of this size
For this protein, even if its gene is constructed in the same expression plasmid with simulated phosphorylated Bcl2 for co-expression, the effect of promoting its expression is not obvious

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • bcl2 mutant capable of promoting large gene expression and its application
  • bcl2 mutant capable of promoting large gene expression and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1: Point Mutation Bcl2

[0018] Mouse Bcl2 cDNA and human Bcl2 cDNA were cloned respectively between Nco I and Sal I of the pMigR1 plasmid, i.e. downstream of the internal ribosome entry site (IRES), see figure 1 . Using a point mutation kit (Transformer, CLONTECH), mutate the nucleotide G at position 568 (codon 577 for human Bcl2) to T, so that the glycine corresponding to position 190 (codon 193 for human Bcl2) The residue codon GGA was replaced with a stop codon TGA. The mutation point is verified by cDNA sequencing. After the verification is correct, the required gene sequence of the mutant Bcl2 (ΔBcl2) with 47 amino acid residues removed from the tail is obtained, and the plasmid containing the ΔBcl2 is pMigR1-ΔBcl2 (containing The plasmid of human ΔBcl2 is pMigR1-ΔhBcl2). Then by the same method, the T codon corresponding to the 69th threonine residue and the S codon of the serine residue at the 70th and 84th positions (the 87th position corresponding t...

Embodiment 2

[0019] Example 2: Construction of a bicistronic retroviral expression vector containing the above-mentioned point mutant mouse Bcl2 and a gene greater than 4.3kb

[0020] Take the pMigR1 plasmid for BglII / SalI digestion, and then use agarose gel electrophoresis to separate and purify the pMigR1 restriction fragment; synthesize 5'GATCTCTCGAGGCGGCCGCCAATTGG3' and 5'TCGACCAATTGGCGGCCGCCTCGAGA3', anneal and ligate with the pMigR1 restriction fragment for introduction Multi-cloning enzyme cutting site BglII-XhoI-NotI-MunI-SalI, after connecting, transform Escherichia coli JM109, carry out screening culture in agarose culture dish containing ampicillin, amplify and cultivate positive Escherichia coli clones, and then extract Purify the plasmid. Sequencing was then performed to verify whether the sequence was correct, and the pMigR1-△GFP plasmid was obtained after verification.

[0021] Using the pMigR1 plasmid as a template, the GFP gene was amplified by PCR, the BglII restriction ...

Embodiment 3

[0022] Example 3: Transfect HEK293 cells and express fusion gene GFP greater than 5kb

[0023] Take two six-well cell culture plates, and culture HEK293 cells derived from human embryonic kidney in nine wells. The specific medium is DMEM supplemented with 15% fetal bovine serum, 2mM L-glutamine, 100 units / ml penicillin, 100 Microgram / ml streptomycin (prepared medium is complete medium). Culture HEK293 cells in this medium and culture them in an incubator at 37°C with 5% carbon dioxide concentration. After the cells are 70-80% confluent in the culture dish, use DMEM containing only 5% fetal bovine serum The medium was washed twice, and then 2 ml of DMEM medium containing only 5% fetal bovine serum was added to each well, and placed in an incubator for use. Take the above-mentioned purified pMigR1-△Bcl2 EEE -GFP-BDD FVIII, pMigR1-Bcl2 EEE -GFP-BDD FVIII and pMigR1-Bcl2 WT -15 micrograms of GFP-BDD FVIII retrovirus expression vector plasmids were dissolved in 750 microliters ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Bcl2 mutant capable of promoting larger gene expression and its application. The Bcl2 mutant of the present invention is that the 190th codon of the mouse Bcl2 gene is mutated from GGA to a stop codon TGA, or the 193rd codon of the human Bcl2 gene is mutated from GGA to a stop codon TGA. In the present invention, by mutating the 568th base (the 577th position of the human Bcl2 gene), G is changed to T, and the mutated phosphorylated Bcl2 and the objective recombinant protein gene are constructed on a bicistronic expression vector. Promote the expression of the target recombinant protein gene larger than 4.3kb.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and specifically relates to a Bcl2 mutant capable of promoting the expression of a gene larger than 4.3kb and its application. Background technique [0002] The Bcl2 gene is an anti-apoptotic gene, which is currently used in the in vivo screening of gene therapy and the increase of recombinant protein expression in biopharmaceuticals. After research, it was found that when the 69th threonine (T), the 70th and 84th (human Bcl2 is the 87th) serine (S) of mouse Bcl2 were mutated to glutamic acid (E) (these three Mouse Bcl2 with amino acid mutation at one site to glutamic acid is Bcl2 T69E / S70E / S84E , human Bcl2 is Bcl2 T69E / S70E / S87E ), simulating phosphorylation at these three sites can significantly improve the anti-apoptotic ability of Bcl2, so phosphorylated Bcl2 protein is also used to increase the expression of recombinant protein. However, for the relatively large target recombinant prot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/47C07K14/755C12N15/67
CPCC07K14/4747C07K14/755C12N15/67C12N2830/20
Inventor 王彦刈
Owner HANGZHOU DIANZI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com