Primer set for identifying chicken parvovirus and chicken infectious anemia virus, and application thereof
A chicken infectious anemia, parvovirus technology, applied in the direction of microbes, microbe-based methods, microbe determination/testing, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1. Primer design
[0029] A large number of sequence analysis and comparisons have obtained several primers for the identification of chicken parvovirus and several primers for the identification of chicken infectious anemia virus. Pre-experiments are performed on each primer to compare the sensitivity, specificity and other properties, and finally primer pair I and primer pair II for identifying chicken parvovirus and chicken infectious anemia virus of the present invention are obtained.
[0030] The specific primer pair used to identify chicken parvovirus (primer pair I for short) consists of the following two primers (5'→3'):
[0031] ChPV-F (SEQ.ID.NO.1): GCCATCTCAACAGTTCATG;
[0032] ChPV-R (SEQ.ID.NO.2): TGGGACCTCATTCTTACC;
[0033] The specific primer pair used to identify chicken infectious anemia virus (referred to as primer pair II) consists of the following two primers (5'→3'):
[0034] CIAV-F (SEQ.ID.NO.3): CCCCAATCTACTATGACTATCC;
[0035] CIAV-R (SEQ.ID.NO.4):...
Embodiment 2
[0037] Example 2. Optimization of double PCR reaction conditions 1. Preparation of template
[0038] 1. Extract the genomic DNA of chicken parvovirus to obtain sample A.
[0039] 2. Extract the DNA of chicken infectious anemia virus to obtain sample B.
[0040] 3. Mix sample A and sample B to obtain a mixed sample.
[0041] 2. Optimization of primer concentration
[0042] Take the mixed sample obtained in step 1 as a template, and use the primer combination prepared in Example 1 to perform double PCR.
[0043] Double PCR reaction system (25.0μL): contains 2×PCR Mix 12.5μL, the mixed sample obtained in step 1 is 2.0μL (in the 2.0μL mixed sample, the content of chicken parvovirus genomic DNA is 1.0ng, chicken infectious anemia The content of virus DNA is 1.0ng), primer pair I and primer pair II, and finally ddH 2 Make up O to 25.0 μL.
[0044] According to the concentration of primer pair I and primer pair II in the reaction system, 9 different reaction systems are set up, as follows:
[00...
Embodiment 3
[0074] Example 3. Specificity
[0075] 1. Extract the genomic DNA of the sample to be tested. The samples to be tested are: chicken parvovirus (ChPV), avian adenovirus type 4 (FadV-4), Marek virus (MDV), and infectious laryngotracheitis virus (ILTV).
[0076] 2. Extract the total RNA of the sample to be tested and reverse transcribed into cDNA. The samples to be tested are: avian nephritis virus (ANV), chicken Newcastle disease virus (NDV), H9 subtype avian influenza virus (AIV-H9), and infectious bronchitis virus (IBV).
[0077] 3. Using each genomic DNA sample obtained in step 1, each cDNA sample obtained in step 2, and the mixed sample obtained in step 1 of Example 2 as templates, the primer combination prepared in Example 1 is used to perform double PCR.
[0078] Double PCR reaction system (25.0μL): contains 2×PCR Mix 12.5μL, template 2.0μL, primer pair I and primer pair II, and finally ddH 2 Make up O to 25.0 μL. In the double PCR reaction system, the concentrations of ChPV-F a...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com