Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strains from gene deletion strains

An African swine fever virus and gene deletion technology, applied in the field of virus strain identification, can solve problems such as cumbersome steps, unfavorable rapid identification, etc., and achieve the effects of good repeatability, reduction of detection cost and detection time, and cost reduction.

Active Publication Date: 2019-12-10
SOUTH CHINA AGRI UNIV +1
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are cumbersome steps, which is not conducive to rapid identification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strains from gene deletion strains
  • Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strains from gene deletion strains
  • Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strains from gene deletion strains

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Primer Design

[0038]The inventor compared a large number of CD2V, P72, 360-505R genes of African swine fever virus (ASFV) published in the GenBanK database of NCBI (National Center for Biological Information), which are highly conserved and have specific regions, designed as ASFVCD2V, P72, 360 The -505R gene is a pair of specific primers, respectively named as P1, P2, P3, P4, P5, and P6, thereby providing a PCR primer for distinguishing ASFV wild-type strains and gene-deleted strains, specifically:

[0039] P1: ASFV-P72-F: 5'AACCAGTGGCCCTCTCCTAT 3' (SEQ ID NO: 1);

[0040] P2: ASFV-P72-R: 5'AATCGCATTGCCTCCGTAGT 3' (SEQ ID NO: 2);

[0041] P3: ASFV-CD2V-F: 5' TCCTAAGCCTTACAGTCGTTATCAGT 3' (SEQ ID NO: 3);

[0042] P4: ASFV-CD2V-R: 5'AGATAATGGCGGGATATTGGGTAGT 3' (SEQ ID NO: 4);

[0043] P5: ASFV-360-505R-F: 5' TCTTGTCCTTTTCATACGCCTCAT 3' (SEQ ID NO: 5);

[0044] P6: ASFV-360-505R-R: 5'GAGCACACCTGGGACCTCT 3' (SEQ ID NO: 6).

[0045] P1 and P2 are used to am...

Embodiment 2 3

[0048] Embodiment 2 Triple PCR detection method

[0049] Materials and Methods

[0050] 1.1 Primers in Example 1

[0051] 1.2 Sample DNA extraction

[0052] There are no special requirements for DNA extraction, which can be extracted according to conventional methods or DNA extraction kits. The extracted DNA was stored at -20°C for later use or immediately used for PCR amplification.

[0053] 1.3 Positive plasmid

[0054] Using the partial gene sequences of ASFV CD2V, P72, and 360-505R published in the GenBanK database to artificially synthesize the gene, connect it to the pJET1.2 cloning vector, transform Escherichia coli competent cell DH5α, and spread it on LB containing 100mg / L ampicillin On the culture medium plate, culture at 37°C for 12-16 hours. After the bacteria were picked, screened and identified by sequencing, the positive bacteria were expanded and cultured, and the plasmids were extracted. The positive plasmids were named pJET-P72, pJET-CD2V and pJET-360-505...

Embodiment 3

[0067] Embodiment 3 specificity test

[0068] According to the triple PCR detection method established in 1.4 of Example 2, pair 1: wild strain without gene deletion; 2: deletion CD2V strain; 3: deletion CD2V and 360-505R strain; 4: positive plasmid (P72); 5: negative Control (DEPC water); 6: classical swine fever virus (CSFV); 7: porcine pseudorabies virus (PRV); 8: porcine reproductive and respiratory syndrome virus (PRRSV); 9: porcine parvovirus (PPV); 10: Porcine encephalitis virus (JEV); 11: rotavirus (RV); 12: porcine epidemic diarrhea virus (PEDV); 13: porcine deltacoronavirus (PDCoV), for detection. The results are attached figure 2 shown.

[0069] From attached figure 2 As can be seen in the figure, corresponding to 1: wild strain without gene deletion; 2: deletion of CD2V strain; 3: deletion of CD2V and 360-505R strain; 4: positive plasmid (P72) in the corresponding fragment size. See clear bands, while negative control (DEPC water); 6: classical swine fever vi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a triple PCR detection primer set for rapidly distinguishing African swine fever virus wild strains from CD2V and / or 360-505R gene deletion strains. Nucleotide sequences of three pairs of detection primers are as shown in SEQ ID NO: 1-6. Three pairs of primers are utilized to amplify three genes of African swine fever viruses CD2V, P72 and 360-505R at a time, so that the detection cost for identifying different genes is reduced, and the detection time for identifying different genes is shortened; and moreover, three genes with different lengths can be amplified only byone-time PCR reaction, and whether gene deletion exists in the strains or not can be distinguished. The three genes can be identified by one-time PCR amplification only, the cost is reduced by about 2 / 3 for a traditional method for respectively amplifying and detecting the samples of the three genes, and the triple PCR detection primer set for rapidly distinguishing the African swine fever virus wild strains from the CD2V and / or 360-505R gene deletion strains has wide market prospect.

Description

technical field [0001] The invention relates to the technical field of virus strain identification methods, more specifically, to a triple PCR detection primer and a kit for quickly distinguishing African swine fever virus wild strains and gene deletion strains. Background technique [0002] African swine fever (ASF) is caused by African swine fever virus (ASFV), which can cause acute hemorrhagic fever, resulting in a large number of morbidity and mortality events (mortality close to 100%) in pigs. The World Organization for Animal Health (OIE) listed it as a must-report animal disease, and my country listed it as a first-class animal disease. Since the first case of African swine fever broke out in my country in 2018, African swine fever has caused major losses to my country's pig industry and seriously affected the healthy development of my country's pig industry. Studies at home and abroad have shown that African swine fever virus CD2V and 360-505R gene knockout can sign...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/93
CPCC12Q1/686C12Q1/701C12Q2600/16C12Q2537/143C12Q2565/125
Inventor 沈永义陈瑞爱张旭
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com