Novel oncolytic virus, as well as preparation method and application thereof
An oncolytic virus, a new type of technology, is applied in the field of biomedicine to achieve the effect of enhancing killing ability, promoting value-added differentiation, and good application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1: Construction and expression verification of recombinant vaccinia virus rTV-AIF-GM-CSF
[0033] 1.1 Construction of pSC65 vector with human AIF-GM-CSF target gene
[0034] The DNA sequence of AIF-GM-CSF was artificially synthesized, and the T2A sequence was used to connect the two genes. The synthesized sequence is shown in SEQ ID NO: 1. The following primers were used to perform PCR amplification using the synthesized DNA sequence as a template. The primers for amplification are:
[0035] AIF-GM-CSF-F: GTACCAGGCCTAGTACTATGTTCCGGTGTGGAGGCCT
[0036] AIF-GM-CSF-R:AATAAGCTCGAAGTCGACTCACTCCTGGACTGGCTCCCAGCAG
[0037] PCR reaction program: pre-denaturation at 94°C for 5 minutes; denaturation at 98°C for 10 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 2 minutes, and 30 cycles of reaction; full extension at 72°C for 10 minutes, and stop at 25°C.
[0038] Recovery of PCR products and clone construction: After amplification, the target gene wa...
Embodiment 2
[0058] Embodiment 2 Amplification of recombinant vaccinia virus rTV-AIF-GM-CSF
[0059] 1. Preparation of 143TK-cells: Spread the cells in a 24-well plate (2×10 5 cells / well), the cell density should reach 100% of the bottom area of the 24-well plate when used;
[0060] 2. Dilute the virus: dilute the vaccinia virus liquid with the maintenance medium, starting from 1:100, make a 10-fold dilution, and the final volume is 1100 μL;
[0061] 3. Discard the complete medium in the 24-well plate, add virus dilution (500 μL / well), and make two duplicate wells. Incubate for about 48 hours at 37°C and 5% CO2, and determine the patching time according to the formation of virus plaques;
[0062] 3. To collect vaccinia virus: Discard 8 mL of medium in the dish, take 2 mL of maintenance medium to blow off the remaining cells, and collect in a 15 mL centrifuge tube;
[0063] 4. After freezing for 24 hours, freeze and thaw the harvested virus solution twice more, then conduct densi...
Embodiment 3
[0064] Titer determination of embodiment three recombinant vaccinia virus rTV-AIF-GM-CSF
[0065] 1.143 TK - Cell preparation: Cells were plated in 24-well plates (2×10 5 cells / well), the cell density should reach 100% of the bottom area of the 24-well plate when used;
[0066] 2. To dilute the virus, dilute the vaccinia virus liquid with the maintenance medium, starting from 1:100, make a 10-fold dilution, and the final volume is 1100 μL;
[0067] 3. Discard the medium in the 24-well plate, add virus dilution (500 μL / well), and make two duplicate wells. 37°C 5% CO 2 Incubate for about 48 hours under certain conditions, and determine the patching time according to the formation of virus plaques;
[0068] 4. Spotting method: Prepare 8 mL of spotting medium containing 2×DMEM medium + 4% FBS + 2% PS and 8 mL of low-melting point agarose melted in a boiling water bath and placed in a 37°C water bath. Mix, then add X-gal to the mixture, the final concentration is 200 μg...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap