Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel piptoporus solonjensis strain, culture method based on mushroom bran matrix and application of novel piptoporus solonjensis strain

A cultivation method and tube-hole technology, which are applied in the field of rare edible fungi and their cultivation, can solve the problems of poor cultivation effect traits and harvest rate, high cultivation method cost, etc.

Active Publication Date: 2019-05-28
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the only patents related to Solonia solonis reported in my country are "Fermentation method of Solonias" and "a nutritional type Solonias and its cultivation method". The cost of the cultivation method is relatively high, and Cultivation effects, including traits and harvest rate, are not good

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel piptoporus solonjensis strain, culture method based on mushroom bran matrix and application of novel piptoporus solonjensis strain
  • Novel piptoporus solonjensis strain, culture method based on mushroom bran matrix and application of novel piptoporus solonjensis strain
  • Novel piptoporus solonjensis strain, culture method based on mushroom bran matrix and application of novel piptoporus solonjensis strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] On July 18, 2015, Mo Weipeng and Feng Jiaqi obtained a fungal fruiting body specimen (HMGIM-A150751) of the genus Piptoporus during the investigation of wild macrofungal resources in West Tianmu, Tianmu Mountain National Nature Reserve, Zhejiang, 2018 On November 20, 2011, its pure culture was preserved in the China Center for Type Culture Collection (CCTCC for short), the address is: Mount Luojia, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the preservation number is CCTCC NO: M 2018756.

[0064] wild fruiting body figure 1 shown.

Embodiment 2

[0066] The sample and pure culture of embodiment 1 are carried out molecular identification identification, and the procedure is as follows:

[0067] Sampling the fruiting body collected in the wild to obtain its bacterial flesh tissue, cultivating the pure culture with cetropol membrane-PDA medium to obtain fresh mycelium, drying at low temperature (40°C), grinding with liquid nitrogen, using The Ezup column type fungal genome DNA extraction kit (Sangon Bioengineering (Shanghai) Co., Ltd.) was used to extract the DNA genome, and the obtained DNA solution (DNA template) was refrigerated at -20°C for later use.

[0068] ITS-PCR experiments were carried out by using the universal primers ITS1 / ITS4 (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTATTGATATGC, synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) for the ribosomal intergenic region of fungi. ITS1 is primer 1, and ITS4 is primer 2. The amplification was carried out on a Biometra PCR instrument, and the composition o...

Embodiment 3

[0073] 1. The cultivation medium is as follows (if no special instructions, all are in weight percentage):

[0074] 1. Culture medium for separating mother species: 20% of sawdust bran juice, 80% of comprehensive PD, and 2% of agar.

[0075] Comprehensive PD medium: potato 20%, glucose 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, vitamin B1 trace, and the rest is water.

[0076] 2. Medium for the production of mother seeds: 20% potato, 2% glucose, 1% peptone, 2% agar, 0.3% potassium dihydrogen phosphate, 0.15% magnesium sulfate, trace amounts of vitamin B1, and the rest is water.

[0077] 3. Raw seed material: 93% to 94% (sorghum, barley, barley or mixture), 5% sawdust, 1 to 2% calcium carbonate.

[0078] 4. The production seed materials include: 38%~42% cottonseed hulls, 36%~40% sawdust, 18%~20% bran, 1%~2% calcium carbonate.

[0079] 5. Cultivation materials include: 30-55% fungus chaff, 15%-30% cottonseed hulls, 15%-25% corn cobs, 12% wheat bran, 2% c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to novel rare edible mushrooms and culture technologies thereof, in particular to a novel piptoporus solonjensis strain, a culture method based on a mushroom bran matrix and application of the novel piptoporus solonjensis strain. The novel piptoporus solonjensis strain is Piptoporus solonjensis HMGIM-A150751, and a preservation number is CCTCC NO: M 2018756. The invention provides the novel piptoporus solonjensis strain and the corresponding artificial culture method. The novel piptoporus solonjensis strain and the corresponding artificial culture method have the beneficial effects that the culture method is low in cost and high in efficiency; the novel piptoporus solonjensis strain are edible-medicinal mushrooms which are low in fat, high in protein, high in folic acid, high in niacin and rich in potassium and magnesium, the nutrition value is high, effective component contents are high, and the novel piptoporus solonjensis strain can be developed to be used forinhibiting mouse breast cancer cell proliferation, and has excellent economic benefits and social benefits.

Description

technical field [0001] The invention relates to a new rare edible fungus and its cultivation technology, in particular to a new strain of Solonia piperifolia and a cultivation method based on fungus chaff substrate and its application. Background technique [0002] Affected by the expansion of industrialization and urbanization, as well as the construction of ecological projects such as returning farmland to forests, returning farmland to grass, and returning farmland to lakes, the country's effective arable land resources are constantly decreasing, which in turn affects the country's food security. The edible fungus industry has the attributes of "not competing with others for food, land, fertilizer, farmers, or resources with other industries", which can turn grass into gold and turn harm into profit. , Turn waste into treasure, waste-free production. At the same time, edible mushroom products are also rich in vitamins, dietary fiber, amino acids and other substances, whi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/14A01H15/00A01G18/00A01G18/20A61K36/07A61P35/00C12R1/645
Inventor 莫伟鹏胡惠萍廖浩锋史钏卓丽君谢意珍
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com