Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mycoplasma pneumoniae rapid detection primer group and kit

A technology of mycoplasma pneumoniae and detection kits, which is applied in the direction of microorganisms, microorganisms, recombinant DNA technology, etc., can solve the problems of high cost experimental design, high possibility of pollution, high operation requirements, etc., and achieve simple detection and nucleic acid amplification Short time, reduce the effect of background fluorescence

Inactive Publication Date: 2019-05-10
苏州晶睿生物科技有限公司
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the fluorescent PCR method also has some disadvantages, including relying on high-cost fluorescent PCR instruments and complex experimental design, and at the same time requiring high operating requirements for experimental technicians, taking a long time, etc. risks of
LAMP technology requires a constant temperature of 65°C, which is relatively high, and has disadvantages such as greater possibility of contamination, false positives, and low specificity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycoplasma pneumoniae rapid detection primer group and kit
  • Mycoplasma pneumoniae rapid detection primer group and kit
  • Mycoplasma pneumoniae rapid detection primer group and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1, Screening of Mycoplasma pneumoniae rapid detection primer set

[0069] Download the conserved sequence of Mycoplasma pneumoniae P1 gene (serial number CP002077.1) from Genebank, design 4 pairs of primers (Table 1) by PrimerPremier 6 software, use EMA universal enzyme, cross-pair the primers, a total of 16 combinations, and amplify separately A plasmid containing the P1 gene sequence. 10-fold serial dilution of the plasmid, the concentration is 1×10 6 copies / μl, 1×105 copies / μl, 1×10 4 copies / μl, 1×103 copies / μl, 1×10 2 Copies / μl, 10c / μl, 1copies / μl, and set a negative control, electrophoresis detection after amplification.

[0070] Table 1 Primer list

[0071] sequence name

sequence

1F

CGTATCGTAACACGAGCTTTTCCTCCC

1R

GCCCGGTTTGGTCGCGCGTGGGCGTTTGCG

2F

GGCCTTAGTGCGCGACAACAGCGCTAAG

2R

AAAGCCGCCAAAGGGGTTAAAGGTGATCTG

3F

GGCAGTCAACAAACCACGTATGATCCC

3R

GACCTCGTTTCACTGTTGGGGTGCAGC

4F

...

Embodiment 2

[0074] Embodiment 2, primary screening of Mycoplasma pneumoniae rapid detection probe

[0075] The sequences of the two public probes designed according to the results of Example 1 are shown in Table 2. The 3 pairs of primers screened in Example 1 were cross-combined with 2 pairs of probes to form 6 combinations. Each combination cooperates with EMA universal enzyme, amplifies the plasmid containing the P1 gene sequence as a template, and the concentration is 1×10 4 copies / μl.

[0076] Table 2 Probe sequence

[0077]

[0078] Probe preliminary screening criteria: the positive fluorescence curve is a typical "S" shape, and the Ct value is the smallest, and the negative fluorescence curve is a horizontal straight line.

[0079] See the results of the preliminary screening of the probe figure 2 . Among them, the 2F / 2R-P2 amplification curve is not a typical "S" type, so it is excluded; line ① is negative for 3F / 4R-P1 amplification, and the negative has an amplification cu...

Embodiment 3

[0084] Embodiment 3, preparation Mycoplasma pneumoniae rapid detection kit

[0085] In this example, the primer set obtained by screening in Example 2 was used. Based on the EMA technology, the lysate, complex solution, and EMA reaction tubes containing primers and probes were designed respectively.

[0086] (1) lysate

[0087] By comparing the collocation, ratio, lysis effect and lysis time of each extraction reagent, the finally selected lysate contains 2-5% NP-40 (v / v), 20-50mg / mL chelex-100, 10 - 20 mM Tris-Ac pH 8.0 and ultrapure water.

[0088] (2) Complex solution and EMA reaction tube containing primer probe

[0089] By repeatedly adjusting the content of primers and probes, and verifying the amplification effect of the reaction system, the best amplification system was formed:

[0090] The selected complex solution contains MgAc2 at a final concentration of 20-30mM, Tris-Ac (pH8.0) at 90-100mM, KAc at 55-60mM, PEG20000 (W / V) at 10-15% and ultrapure water.

[0091...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a mycoplasma pneumoniae (MP) rapid detection primer group and a kit. The mycoplasma pneumoniae rapid detection primer group comprises an upper stream primer, a lower stream primer and a probe which detect a mycoplasma pneumoniae gene group P1 gene sequence. The kit comprises a lysate solution, a reconstitution fluid, an EMA reaction tube containing primer probes, a positive quality control product and a negative quality control product. The primer group can be specifically combined with the mycoplasma pneumoniae P1 gene, and cooperate with EMA (Enzymes Mediated Amplification, a multienzyme mediated nucleic acid amplification technology, namely a normal temperature nucleic acid amplification technology) to prepare the mycoplasma pneumoniae detection kit, and the mycoplasma pneumoniae rapid detection primer group and kit have the advantages of easy to operate, short in consumed time, high in sensitivity and specificity and the like.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a primer set and a kit for rapid detection of Mycoplasma pneumoniae. Background technique [0002] Mycoplasma pneumoniae (Mycoplasma pneumoniae, MP), belonging to the Mollusca class and the genus Mycoplasma, is a prokaryotic microorganism that is between bacteria and viruses and can live independently on an inanimate medium and replicate itself. Mycoplasma pneumoniae can be transmitted through droplets or aerosols during coughing and direct contact, and is generally susceptible to humans, but the onset tends to be younger, especially in children and adolescents whose immune systems are not yet mature. Mycoplasma pneumoniae can cause acute lung infection and is an important pathogen of community acquired pneumonia (CAP) in children and adults. 10%-40% of children with CAP are caused by MP infection, of which about 18% require hospitalization. In addition to pneumonia, Mycoplasma pne...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/04C12N15/11C12R1/35
CPCC12N15/11C12Q1/689C12Q1/04C12R2001/35C12N1/205
Inventor 谭卓胡振新郜安国
Owner 苏州晶睿生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com