Intelligent macrophage tumor targeting therapy system and preparation method and application thereof
A macrophage and reaction technology, applied in the field of biomedicine and nanomedicine, can solve the problems of low drug loading, limiting the therapeutic effect of macrophage drug carrier system, toxic and side effects, etc. Heat-responsive biotherapeutic factor release and growth-inhibiting effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1: Preparation of amino mesoporous silicon nanomaterials coated with hyaluronic acid loaded with indocyanine green.
[0045] (1) Disperse cetyltrimethylammonium bromide (1.0 g) in double distilled water (480 mL), add sodium hydroxide (0.28 g), stir magnetically, heat the oil bath to 80 °C, add dropwise Tetraethyl orthosilicate (5.0 g), after continuous stirring for 2-3 hours, centrifuge (8000 rpm, 10 min) to collect the precipitate, wash with methanol and double distilled water once, and lyophilize in a low-temperature freeze dryer, namely The white powdery mesoporous silicon nanoparticles containing templates were obtained.
[0046] (2) Disperse the mesoporous silicon nanoparticles (1.0 g) obtained in step (1) in methanol (75 mL), add 3-aminopropyltriethoxysilane (2 mL) under magnetic stirring, and react at room temperature After 24 hours, the aminated mesoporous silicon nanoparticles were collected by centrifugation (8000 rpm, 10 min).
[0047] (3) Disperse ...
Embodiment 2
[0050] Example 2: Construction of a monocyte / macrophage cell line overexpressing the signal peptide TNFα.
[0051] (1) Using polymerase chain reaction (Polymerase Chain Reaction, PCR) to amplify the TNFα coding sequence without the signal peptide, and construct the overexpression non-secretion TNFα plasmid DNA by DNA recombination technology. Select plenti-CMV-puro-3×Flag as the carrier plasmid, and cut the plasmid with two restriction enzymes Sal1 and BamH1 (enzyme digestion system: double distilled water 3 μL; plenti-CMV-puro-3×Flag 10 μL; 10×Buffer T 3 μL; Sal1 enzyme 2 μL; BamH1 2 μL; enzyme digestion at 37°C overnight, store at -20°C). PCR technology was used to amplify the gene fragment EGFP coding sequence, wherein forward primer (5'-3'): CTAGATATCTTCGAAGGATCCACCATGGTGAGCAAGGG; reverse primer (5'-3'): ATCCAGAGGTTGATTGTCGACCTTGTACAGCTCGTCCATG. The amplified EGFP coding sequence gene is connected to the vector plenti-CMV-puro through a recombinase reaction, and transform...
Embodiment 3
[0055] Example 3: Existing form and activity detection of overexpressed TNFα protein in macrophages after genetic engineering.
[0056] L929 cells in the logarithmic growth phase were seeded in 96-well plates at 30,000 cells per well, and cultured for 24 hours. The culture supernatants of three kinds of macrophages (wild type, overexpressed EGFP protein, and overexpressed EGFP-TNFα protein) were collected respectively, and after cell counting, the cell suspension was prepared with PBS and lysed by liquid nitrogen freeze-thaw. The culture supernatant and freeze-thawed lysate of macrophages were added to L929 cells at 50,000, 100,000, and 200,000 respectively, and actinomycin D (0.5 μg / mL) was added at the same time, and cultured at 37°C for 48 hours. MTS detects the viability of L929 cells, the existence form and activity of TNFα protein such as image 3 As shown, the culture supernatant of M(ET) did not show cytotoxicity, but the cell lysate of M(ET) showed obvious cytotoxici...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com