Aspergillus usamii epoxide hydrolase mutants with improved enantioselectivity
An enantioselective, epoxide technology, applied in the fields of enzyme engineering and biocatalysis, can solve the problems of low enantioselectivity and limited application potential, and achieve improved enantiopurity and yield, large application potential, The effect of high enantioselectivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1: Site-directed saturation mutation
[0028] (1) Using the recombinant plasmid pET-28a(+)-Aueh2 (see the patent application of Patent Publication No. CN102994470A for the construction method) as a template, A250X-F and pET28-R as primers, using PrimeSTAR DNA polymerase (purchased from TaKaRa) The first round of PCR amplification (95°C 4min; 98°C 10s, 55°C 5s, 72°C 3min, 30 cycles; 72°C 10min) obtained a large primer A250X-1st; using the large primer A250X-1st as a primer, the recombinant plasmid pET-28a(+)-Aueh2 was used as template for the second round of PCR amplification (95°C for 4min; 98°C for 10s, 55°C for 15s, 72°C for 3min, 25 cycles; 72°C for 10 min); I digested (25°C, overnight) the template pET-28a(+)-Aueh2 and transformed E.coli BL21(DE3) competent cells, coated kanamycin-resistant LB plates and cultured at 37°C for 12-16h to obtain recombinants library.
[0029] A250X-F:
[0030] pET28-R:GCCTTACTGGTTAGCAGAATG
[0031] Among them, N represents...
Embodiment 2
[0035] The enantioselectivity of the 36 mutants prepared in Example 1 was determined by chiral liquid chromatography. The bacteria suspension with the epoxide hydrolase mutant prepared in Example 1 was centrifuged to collect the bacteria. Add 5 mg wet bacteria and 900 μL potassium phosphate buffer (pH 7.0) to a 1.5 mL EP tube, incubate at 25 °C for 10 min, then add 100 μL rac-pMPGE (final concentration 20 mmol / L) for reaction. Regular sampling of 100 μL was extracted into 1 mL of ethyl acetate, and sample analysis was performed using a liquid chromatograph Waters-2695 (Waters, USA), a chiral liquid chromatographic column, and an ultraviolet detector.
[0036] The result is as figure 2 shown. mutantAuEH2 A250H , AuEH2 A250R , AuEH2 A250G , AuEH2 A250K , AuEH2 A250N , AuEH2 A250D , AuEH2 A250E , AuEH2 A250Q and AuEH2 A250P Enantiomeric ratios (E-values) of catalyzed racemic p-methylphenyl glycidyl ether (rac-pTO) increased from 12.7 to 32.4, 31.1, 27.8, 25.8, 23.5, 2...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com