Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Aspergillus usamii epoxide hydrolase mutants with improved enantioselectivity

An enantioselective, epoxide technology, applied in the fields of enzyme engineering and biocatalysis, can solve the problems of low enantioselectivity and limited application potential, and achieve improved enantiopurity and yield, large application potential, The effect of high enantioselectivity

Active Publication Date: 2019-04-12
JIANGNAN UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the enantioselectivity of the recombinant enzyme to epoxides is not high, which limits its application potential in the chiral synthesis of high value-added prodrugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aspergillus usamii epoxide hydrolase mutants with improved enantioselectivity
  • Aspergillus usamii epoxide hydrolase mutants with improved enantioselectivity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Site-directed saturation mutation

[0028] (1) Using the recombinant plasmid pET-28a(+)-Aueh2 (see the patent application of Patent Publication No. CN102994470A for the construction method) as a template, A250X-F and pET28-R as primers, using PrimeSTAR DNA polymerase (purchased from TaKaRa) The first round of PCR amplification (95°C 4min; 98°C 10s, 55°C 5s, 72°C 3min, 30 cycles; 72°C 10min) obtained a large primer A250X-1st; using the large primer A250X-1st as a primer, the recombinant plasmid pET-28a(+)-Aueh2 was used as template for the second round of PCR amplification (95°C for 4min; 98°C for 10s, 55°C for 15s, 72°C for 3min, 25 cycles; 72°C for 10 min); I digested (25°C, overnight) the template pET-28a(+)-Aueh2 and transformed E.coli BL21(DE3) competent cells, coated kanamycin-resistant LB plates and cultured at 37°C for 12-16h to obtain recombinants library.

[0029] A250X-F:

[0030] pET28-R:GCCTTACTGGTTAGCAGAATG

[0031] Among them, N represents...

Embodiment 2

[0035] The enantioselectivity of the 36 mutants prepared in Example 1 was determined by chiral liquid chromatography. The bacteria suspension with the epoxide hydrolase mutant prepared in Example 1 was centrifuged to collect the bacteria. Add 5 mg wet bacteria and 900 μL potassium phosphate buffer (pH 7.0) to a 1.5 mL EP tube, incubate at 25 °C for 10 min, then add 100 μL rac-pMPGE (final concentration 20 mmol / L) for reaction. Regular sampling of 100 μL was extracted into 1 mL of ethyl acetate, and sample analysis was performed using a liquid chromatograph Waters-2695 (Waters, USA), a chiral liquid chromatographic column, and an ultraviolet detector.

[0036] The result is as figure 2 shown. mutantAuEH2 A250H , AuEH2 A250R , AuEH2 A250G , AuEH2 A250K , AuEH2 A250N , AuEH2 A250D , AuEH2 A250E , AuEH2 A250Q and AuEH2 A250P Enantiomeric ratios (E-values) of catalyzed racemic p-methylphenyl glycidyl ether (rac-pTO) increased from 12.7 to 32.4, 31.1, 27.8, 25.8, 23.5, 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses Aspergillus usamii epoxide hydrolase mutants with improved enantioselectivity, and belongs to the technical fields of enzyme engineering and biocatalysis. Based on rational design, molecular transformation of the Aspergillus usamii epoxide hydrolase (AuEH2) is carried out; and combined with a site-directed saturation mutation method, a plurality of epoxide hydrolase mutantswith enhanced enantioselectivity are obtained. Enantiomeric ratios (E value) of the 9 enantioselectivity-enhanced mutants catalyzing rac-pMPGE are increases to 32.4, 31.1, 27.8, 25.8, 23.5, 22.4, 20.2, 14.1, and 13.6 correspondingly compared to an E value of 12.7 of a wild type.

Description

technical field [0001] The invention relates to an aspergillus usami epoxide hydrolase mutant with improved enantioselectivity, which belongs to the technical field of enzyme engineering and biocatalysis. Background technique [0002] Chiral epoxides and vicinal diols are important intermediates for the synthesis of various active substances in industries such as chiral drugs, agriculture, spices and fine chemicals, and have broad application prospects and market demands. Photoactive chiral compounds have unique properties different from racemates, and their differences in metabolic pathways, metabolic rates, pharmacology and toxicity in vivo make them have new and special uses in the chemical and life science industries . In the 1960s, the "reaction stop event" that shocked the world has fully demonstrated the necessity of obtaining optically pure compounds. The traditional chemical splitting of epoxides often requires heavy metals and toxic substances as catalysts, which...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/14C12N15/55C12N15/70C12N1/21C12P41/00C12P7/22
CPCC12N9/14C12N15/70C12P7/22C12P41/00C12Y303/02003
Inventor 苏永君王婷婷徐雄峰文正胡博醇胡蝶李剑芳邬敏辰
Owner JIANGNAN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More