Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Ribosomal protein L9e, a lethal gene fragment of SBPH and its application

A technology of gene fragments and striatellus, applied in the field of agricultural biology, can solve the problems of environmental pollution, poor control effect of chemicals, etc., and achieve the effect of low synthesis cost, significant lethal effect, and convenient large-scale application

Inactive Publication Date: 2021-02-05
ZHEJIANG UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle
In addition, rice stripe leaf blight caused by stripe virus transmitted by SBPH is poorly controlled by pesticides after the onset, and can only be controlled by pest control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ribosomal protein L9e, a lethal gene fragment of SBPH and its application
  • Ribosomal protein L9e, a lethal gene fragment of SBPH and its application
  • Ribosomal protein L9e, a lethal gene fragment of SBPH and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Cloning method of Ribosomal protein L9e gene fragment:

[0037] (1) Get 10-20 heads of SBPH, and use the TRIzol method to extract total RNA;

[0038] (2) Synthesizing the first strand of cDNA;

[0039] (3) Obtain the gene fragment sequence from the SBPH transcriptome, in http: / / www.ncbi.nlm.nih.gov / After the homology comparison, it was predicted to be the Ribosomal protein L9e gene of S. striatellus. Using Primer premier 5.0 software, P 1 and P 2 were designed and amplified by RT-PCR;

[0040] Upstream primer (P1): 5'GTTATCGTTGCGTCTGTT 3'(SEQ ID NO.2),

[0041] Downstream primer (P 2): 5'GCGCCATTCGCACCCTTC 3' (SEQ ID NO.3);

[0042] PCR conditions are: denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 55°C, 30sec at 72°C, 35 cycles, extension at 72°C

[0043] PCR reaction system (50μL):

[0044]

[0045] (4) The PCR product is separated by agarose gel electrophoresis, and the target DNA fragment is recovered;

[0046](5) Insert the recovered target fra...

Embodiment 2

[0050] Embodiment 2.dsRNA synthesis and recovery

[0051] (1) According to the verified Ribosomal protein L9e gene fragment sequence, use Primer Premier5.0 software to design P3 and P4;

[0052] Upstream primer (P3): 5'TAATACGACTCACTATAGGGTATCGTTGCGTCTGTTT 3'(SEQ ID NO.5)

[0053] Downstream primer (P4): 5'TAATACGACTCACTATAGGGTACCGACTTTGTCCATTAG 3'(SEQ ID NO.6)

[0054]

[0055] PCR conditions: Denaturation at 94°C for 2min, 30sec at 94°C, 30sec at 60°C, 30sec at 72°C, 38 cycles, extension at 72°C.

[0056] (2) The PCR product was separated by electrophoresis on a 1% low-melting point agarose gel and observed under ultraviolet light. The sequence is shown in SEQ ID NO.4.

[0057] (3) Using Promega's SV Gel and PCR Clean-Up System kit for recovery:

[0058] ① Cut the gel of the separated target fragment, put it into a 1.5ml microcentrifuge tube that has been weighed in (a), weigh (b) again, and calculate the weight of the cut gel in b-a;

[0059] ② According to the gel...

Embodiment 3

[0068] Example 3 Planthopper feeding dsRNA experiment

[0069] (1) Seal one end of the glass tube with a parafilm, absorb second-instar planthoppers (BPH, BPH) into different glass tubes with an insect sucker, and seal the other end with gauze;

[0070] (2) Gently pat the insects to one end with your hands, remove the gauze from the other end, and put the prepared parafilm sticker face up, pull evenly to both sides, pull it into a square, and then cover it on the glass On the nozzle of the tube, place the tube upright on the ultra-clean table;

[0071] (3) Use a pipette gun to draw 100 μl of feed and drop it in the center of the parafilm. The control group only adds feed (see Table 2 for formula), and the treatment group adds dsRNA of Ribosomal protein L9e gene to the feed. The dsRNA concentration is 3400ng / μl. A new parafilm, with the sticker side down, is attached to the mouth of the glass tube, and the feed and dsRNA are sealed between the two layers of parafilm;

[0072]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a lethal gene segment Ribosomal protein L9e of small brown planthopper and an application of the lethal gene segment. The lethal gene segment Ribosomal protein L9e, capable ofresulting in small brown planthopper death after interference and has the sequence represented as SEQ ID NO.1, of small brown planthopper is screened out, when dsRNA of the gene segment is utilized for feeding small brown planthopper and brown planthopper, the small brown planthopper and the brown planthopper can be effectively killed, the lethal gene segment is safe to ecological environment andfood, and a new way is provided for pest control with the RNA interference technology.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and relates to the lethal gene fragment Ribosomal protein L9e of the striatellus striatellus and an application thereof. Background technique [0002] In my country, the continuous single long-term use of chemical agents has led to varying degrees of resistance of the planthopper to various pesticides. It is necessary to continuously increase the amount of pesticides used to achieve satisfactory control effects, resulting in more serious environmental pollution. vicious circle. In addition, the rice stripe leaf blight caused by the stripe virus transmitted by the striatellus striatellus is poorly controlled by pesticides after the onset, so we can only rely on pest control to prevent disease. Therefore, in the practice of agricultural production, there is an urgent need for alternative control methods other than chemical pesticides. [0003] RNA interference (RNA interference, RNAi) is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C12N15/11C12N15/113A01N57/16A01P7/04
CPCA01N57/16C07K14/43563C12N15/113C12N2310/14
Inventor 王亚琴王书平李飞贺康肖花美胡涛
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com