Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kinase gene LeRLK1-V, and expression vector and application thereof

An expression vector and gene technology, applied in the field of the kinase gene LeRLK1-V and its expression vector, can solve the problems of rapid virulence variation, large outbreaks of wheat powdery mildew, and agricultural production disasters, and achieve the effect of improving resistance

Active Publication Date: 2018-07-31
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the large number of physiological races of wheat powdery mildew and rapid virulence variation, once a new toxic race is produced or the population of the race changes, it will lead to a large outbreak of wheat powdery mildew and bring disastrous consequences to agricultural production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kinase gene LeRLK1-V, and expression vector and application thereof
  • Kinase gene LeRLK1-V, and expression vector and application thereof
  • Kinase gene LeRLK1-V, and expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Cloning of a kinase gene LeRLK1-V with lectin and LRR domains in the wheat-P.

[0024] The Wheat-Glutella pilosa translocation line 6VS / 6AL Nannong 9918 is a wheat variety containing the broad-spectrum powdery mildew resistance gene Pm21 bred by the Institute of Cytogenetics of Nanjing Agricultural University (Gongzhi Gonggong, Chen Peidu, Zhang Shouzhong, Wang Xiu'e, Wang Suling, Zhou Bo, Feng Yi Gao, Liu Dajun. Nannong 9918, a new wheat variety resistant to powdery mildew and high yield. Journal of Nanjing Agricultural University, 2002,25(4):1438-1444). In the early stage, multiple 6VS transformation sequences have been developed on the 6VS of Nannong 9918, and the small fragment insertion translocation line NAU418 was further used to limit Pm21 between 6EST258 and CINAU15, and there are two 6EST243 and 6EST238 in the chromosome interval where Pm21 is located Marker (known and public, Radiation-induced translocations with reduced Haynaldia villosa chromatin ...

Embodiment 2

[0027] Example 2 The expression of LeRLK1-V was induced by powdery mildew in the translocation line 6VS / 6AL Nannong 9918 of wheat-P.

[0028] Using the cDNA samples of the wheat-Tamophila translocation line 6VS / 6AL Nannong 9918 induced by powdery mildew for different periods of time as templates, primers P3 (TCCGCAGTTATCACATCAGC, SEQ ID NO.5) and P4 (CATTCTTGCATCCAATGC , SEQ ID NO.6) was used as primer for Q-PCR analysis. The PCR program is as follows: the PCR reaction is amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad Company, USA) and the fluorescence is detected. The 20uL PCR reaction system contains 10uL of 2×SYBR Green PCR Master Mix, 0.5μM primers P3 and P4, and 2uL of reverse transcription cDNA template. The amplification parameters were: 95°C for 10 minutes, then 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 1 minute, a total of 40 cycles. After the reaction, the measurement of the melting curve was carried out. The detected ...

Embodiment 3

[0029] Example 3 Construction of LeRLK1-V Gene Transient Expression Vector

[0030]Using the LeRLK1-V gene cDNA cloned in Nannong 9918 induced by powdery mildew as a template, the primer pair NLR1-V-BamHI-F (GGAGAGAACACGGGGGATCCATGGATCTATGCGTAGTGATTCTCC, SEQ ID NO. ID NO.8) perform PCR amplification, and recover the amplified fragment. The amplified product was double digested with BamHI and StuI, and the digested product was inserted into the vector pBI220 (Jefferson RA, Kavanagh TA, Bevan MW. GUSfusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higherplants.EMBO J.1987,6:3901-3907.), put LeRLK1-V at the multiple cloning site behind the 35S promoter. Thus, the target gene LeRLK1-V was cloned to the downstream of the strong promoter 35S, and the expression vector pBI220:LeRLK1-V( figure 1 ). It was verified by sequencing that the vector was constructed successfully.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kinase gene LeRLK1-V, and an expression vector and application thereof, belonging to the field of genetic engineering. The cDNA sequence of LeRLK1-V is SEQ ID No. 1, and an amino acid sequence coded by LeRLK1-V is SEQ ID No. 2. The gene LeRLK1-V is derived from the 6VS chromosome arm of the Triticum aestivum-Haynaldia villosa translocation line 6VS / 6AL Nannong 9918. LeRLK1-V is enhanced in expression under the induction of powdery mildew in the powdery-mildew-resistant wheat variety Nannong 9918. The gene is used for transforming the susceptible wheat variety Yangmai158 by transient expression, and results show that the overexpression of LeRLK1-V can reduce the haustorium index of Yangmai 158. Therefore, LeRLK1-V is expected to be applied to genetic engineering breeding; and as LeRLK1-V is introduced into wheat varieties susceptible to powdery mildew, the powdery mildew resistance of the wheat varieties is expected to be improved.

Description

technical field [0001] The invention belongs to the field of genetic engineering and discloses a kinase gene LeRLK1-V, its expression vector and application. Background technique [0002] The whole growth period of wheat (Triticum aestivum) is harmed by various diseases and insect pests, among which the wheat powdery mildew caused by the infection of wheat powdery mildew (Blurmeria graminis f.sp.tritici, Bgt) is one of the most serious fungal diseases of wheat. Because wheat powdery mildew has many physiological races and rapid virulence variation, once a new toxic race is produced or the population of the race changes, it will lead to a large outbreak of wheat powdery mildew and bring disastrous consequences to agricultural production. The discovery and utilization of broad-spectrum and long-lasting disease resistance genes are of great significance to the control of powdery mildew. [0003] The powdery mildew resistance gene Pm21 carried by wheat tufts (Haynaldia villosa,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/12C12N15/82A01H5/00A01H6/46
CPCC12N9/12C12N15/8282
Inventor 曹爱忠胡平刘佳倩邢莉萍张瑞奇张守忠陈佩度
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products