A vector suitable for the genetic transformation and cloning of fungi such as Chinese Mortierella hirsutella sinensis and its construction method
A technology of vector and insect-growing fungi, applied in the field of genetic engineering, can solve the problems such as the unseen eGFP gene, and achieve the effect of good application prospect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1 Construction of the recombinant plasmid of the present invention
[0040] 1. Full-length cloning of promoters pAT and pTrpc
[0041] Follow these steps:
[0042] (1) According to the entomogenous fungus genome information, first find the pAT and pTrpc gene sequence information, and then find its promoter sequence information at the front end of the AT protein and trpc gene;
[0043] (2) According to the promoter sequence information found in the entomogenous fungal genome, design corresponding amplification promoter-specific primers:
[0044] pAT-F: GTTGAGTTTGTTGATTGCAAT
[0045] pAT-R: AACCGTATACGATTCTAGCT
[0046] pTrpc-F: ACGTCAACGATACGTGCTAAC
[0047] pTrpc-R: CAAGCTTTTCTAGTGCACCTACG
[0048] The total DNA of entomogenous fungi was extracted by CTAB method, using Premix Taq TM The promoter pAT and pTrpc fragments were amplified by PCR. The PCR reaction volume is 20 μL, including 10 μL Mix, 1 μL forward primer, 1 μL reverse primer, 1 μL DNA template...
Embodiment 2
[0084] Embodiment 2 Construction of engineering bacteria of the present invention
[0085] (1) Preparation of Agrobacterium tumefaciens competent cells and vector transformation
[0086] A single colony of Agrobacterium tumefaciens AGL-1 was picked, inoculated in 5ml LB (containing 20 μg / mL Rif) liquid medium, and cultured at 28°C with shaking at 200r / min for 15h.
[0087] Add 2 mL of overnight cultured bacterial solution to 50 mL of LB medium containing the same antibiotic, shake at 28°C for 3.5 hours at 200 r / min, until OD 600 ≈0.6~0.7; draw the bacterial liquid into a 50mL pre-cooled centrifuge tube, put it in an ice bath for 10min; centrifuge at 5000r / min at 4°C for 10min, discard the supernatant; slowly add 10mL of pre-cooled 100mM CaCl 2 solution, gently suspend the Agrobacterium cells, and place in an ice bath for 30 min; centrifuge at 5000 r / min at 4°C for 10 min, discard the supernatant, and add 2 mL of pre-cooled 100 mM CaCl containing 15% glycerol on ice 2 solutio...
experiment example 1
[0092] Experimental Example 1 Transformation of Hirsutella sinensis with plasmid pRF-AETH
[0093] 1. Method for Agrobacterium tumefaciens-mediated genetic transformation of Hirsutella sinensis in China
[0094] (1) Pre-induction of Agrobacterium tumefaciens
[0095] Agrobacterium tumefaciens AGL-1 / pRF-AETH was streak inoculated, cultured at 28°C for 2 days, picked a single clone with a sterile pipette tip and inoculated into 10 mL liquid LB medium, and cultured at 28°C, 200 r / min for 15 hours.
[0096] Centrifuge the Agrobacterium cultured overnight, discard the supernatant, resuspend twice in an equal volume of IM medium, and then adjust the concentration of Agrobacterium to OD 600 ≈0.15~0.20, add AS (acetosyringone) to a final concentration of 200 μM. 28°C, 200r / min continue to culture for 6h to OD 600 ≈0.6~0.7 can be used for co-culture transformation of Agrobacterium tumefaciens and Hirsutella sinensis. IM medium formula: 10mM Glucose, 0.6mM CaCl 2 , 9μM FeSO 4 , 50...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com