Supercharge Your Innovation With Domain-Expert AI Agents!

Genetic engineering application of rice gene ORYsa;SIZ2

A technology of genetic engineering, rice, applied in the direction of genetic engineering, applications, DNA/RNA fragments, etc.

Active Publication Date: 2017-11-17
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the existence of various factors, the concentration of nitrogen and phosphorus in the soil that can be directly absorbed by plants is far lower than that required for normal growth and development of plants, making them the main limiting factors for plant growth and development.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering application of rice gene ORYsa;SIZ2
  • Genetic engineering application of rice gene ORYsa;SIZ2
  • Genetic engineering application of rice gene ORYsa;SIZ2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029]Embodiment 1, ORYsa; Identification of the expression pattern of OsSIZ2 gene

[0030] 1.1 Extraction and transcription of total RNA to synthesize the first strand of cDNA

[0031] The Nipponbare wild-type rice variety with uniform growth and seedling age of three weeks was selected and transplanted into potted pottery. The pot experiment was carried out at the archway base of Nanjing Agricultural University. (12 weeks) and filling stage (16 weeks) to take samples for expression analysis. Samples in the vegetative growth stage include: roots, rhizome junctions, leaf sheaths and leaves; samples in the reproductive growth stage are: roots, rhizome junctions, other leaf sheaths, other leaves, flag leaf sheaths, flag leaves, immature panicles, node 1 -3. Cob stalks, cobs and rice husks. Total RNA was extracted from the sampled samples using TriZol reagent, and the quality of total RNA was identified by agarose gel electrophoresis, and then the RNA content was determined on ...

Embodiment 2

[0040] Embodiment 2, ORYsa; The acquisition of RNAi and T-DNA insertion mutant material of OsSIZ2 gene

[0041] 2.1 ORYsa; Construction of OsSIZ2-RNAi vector

[0042] The carrier pTCK303 commonly used in this laboratory was selected as the RNAi carrier, according to (Wang, Z.A practical vector for efficient knockdown of gene expression in rice.Plant Molecular Biology Reporter.2004,22:409-417 Figure 8 ) literature method, according to the open reading frame (ORF) sequence of the OsSIZ2 gene, a part of the ORF fragment of the target gene was intercepted, and the primers for the RNAi expression vector were designed. Two restriction sites, BamH I and Kpn I, plus two protective bases are added to the 5' end of the forward primer; two restriction sites, Sac I and Spe I, plus three protective bases are added to the 5' end of the reverse primer base. The primer sequences are as follows:

[0043] Forward sequence: F: GGATCCTTAAGACGGCCACCTGTTTC (SEQ ID NO.4)

[0044] R: GTGGTACCGAG...

Embodiment 3

[0055] Example 3, ORYsa; Functional identification of OsSIZ2 gene in phosphorus nutrition

[0056] 3.1 Effects of partial silencing of OsSIZ2 on phosphorus uptake and transport during rice vegetative growth

[0057] In order to analyze the role of OsSIZ2 in the mechanism of phosphorus nutrient uptake and transport in rice, we conducted hydroponic experiments on the molecularly identified OsSIZ2-RNAi silencing materials. The 3-day-old OsSIZ2-RNAi silencing material and its wild-type seedlings with uniform growth were transplanted into normal phosphorus supply and phosphorus-deficient nutrient solutions. After 21 days, the plants were divided into two parts: leaves and roots. Extractable phosphorus concentration. It was found that under normal phosphorus supply conditions, the concentrations of extractable phosphorus in leaves and roots of OsSIZ2-RNAi silenced materials were significantly increased by 36-65% and 34-48% ( image 3 A); Under phosphorus deficiency conditions, the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene engineering application of a rice gene ORYsa;SIZ2. The rice SUMO conjugation modified E3 ligase gene ORYsa;OsSIZ2 is applied to genetic engineering breeding for changing the rice seed morphology. The gene can be further applied to genetic engineering breeding for promoting dehiscence of rice anthers and / or improving the pollen fertility of rice. The accession number of the rice SUMO conjugation modified E3 ligase gene ORYsa;OsSIZ2 is Os03g0719100, the sequence of coded amino acids of the rice SUMO conjugation modified E3 ligase gene ORYsa;OsSIZ2 is SEQ ID NO.1. The gene engineering application of the rice gene ORYsa;SIZ2 provides a basis for breeding a novel rice variety suitable for phosphorous barren soil.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, and relates to the genetic engineering application of rice gene ORYsa; SIZ2. Background technique [0002] Rice is one of the most important food crops in the world. Its planting area accounts for 1 / 3 of the world's cereal crops, and about half of the world's population uses rice as a staple food. China is the country with the largest rice planting area in the world, accounting for about 20% of the world's total, and rice production accounts for 50% of the country's total grain output. It is an important crop to ensure my country's food security (Hu Peisong et al., 2002; Peng Shaobing et al., 2002) . [0003] Nitrogen and phosphorus are macronutrient elements necessary for plant growth and development, accounting for 2-5% and 0.05-0.5% of plant dry weight respectively (Vance, C.P. Phosphorus acquisition and use: critical adaptations by plants for securing a nonrenewable resource...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/52C12N15/82A01H5/00
CPCC12N9/93C12N15/8218C12N15/8241C12N15/8243C12N15/8261C12N15/827
Inventor 孙淑斌徐国华裴文霞孙瑞
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More