Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Inducible CRISPRon or CRISPRi mouse embryo stem cells and application thereof

A mouse embryo and stem cell technology, applied in embryonic cells, cells modified by introducing foreign genetic material, applications, etc., can solve problems such as genome changes, and achieve stable expression, high homologous recombination efficiency, and high efficiency.

Active Publication Date: 2017-09-08
TIANJIN MEDICAL UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the method relies on the random insertion of the transposase system, which may cause unexpected genomic changes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Inducible CRISPRon or CRISPRi mouse embryo stem cells and application thereof
  • Inducible CRISPRon or CRISPRi mouse embryo stem cells and application thereof
  • Inducible CRISPRon or CRISPRi mouse embryo stem cells and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Preparation of inducible CRISPRon and CRISPRi mouse embryonic stem cells

[0041] PCR was performed using dCas9-VPR and dCas9-KRAB expression vectors (Addgene #63800 and #50917) as templates, respectively. See Table 1 for PCR primers.

[0042] Table 1 PCR primers

[0043] Primer name Sequence (5'-3') SEQ ID NO. dCas9-VPR upstream primer ATGGACAAGAAGTACTCCATTGG 1 dCas9-VPR downstream primer TTAAAACAAACTTGTGTCAAATA 2 dCas9-KRAB upstream primer ATGGACAAGAAGTACTCCATTGG 3 dCas9-KRAB downstream primer TTATACCAGCCAAGGTTCTTCCC 4

[0044] PCR reaction system:

[0045]

[0046]

[0047] Add 10μl easy Taq enzyme and extend at 72°C for 20min.

[0048] The above two PCR fragments were respectively constructed on the pCR8-Entry vector (Invitrogen), and then by LR reaction (Invitrogen TM Gateway TM cloning system) into the p2Lox-FLAG vector containing LoxP sites (Mazzoni, E.O. et al., 2010), and the resulting cons...

Embodiment 2

[0059] Example 2 Inducibility and reversibility of dCas9-VPR or dCas9-KRAB fusion protein expression

[0060] The mouse embryonic stem cell clone TRE-dCas9-VPR or TRE-dCas9-KRAB obtained in Example 1 was placed in a mouse embryonic stem cell culture medium (GMEM medium, 15% fetal bovine serum, 0.1mM β-mercaptoethanol, 2mM glutamine , 0.1mM non-essential amino acids, 1% penicillin / streptomycin, 1mM sodium pyruvate, 5ng / ml LIF (leukemia inhibitory factor), the culture dish used for mouse embryonic stem cells should be pre-coated with 0.1% gelatin) , add doxycycline at a final concentration of 500ng / ml, remove doxycycline after 24 hours of culture, replace with mouse embryonic stem cell medium without doxycycline, and then culture for 24, 48, and 72 hours respectively; Kinetin was used as an internal reference. The expression levels of dCas9-KRAB and dCas9-VPR fusion proteins were detected by western blot, and the results were as follows image 3 As shown, dCas9-KRAB and dCas9-...

Embodiment 3

[0062] Example 3 Regulation of target gene expression by sgRNA targeting genes

[0063] (1) Design the sgRNA targeting Nkx2.5 according to the sequence near the transcription start site, and its sequence is SEQ ID NO.5: CGGGCGGCGGGCACCATGCG. The design method of sgRNA is a routine technique in the art, and those skilled in the art can also choose sgRNA design software or online design (such as http: / / www.e-crisp.org / E-CRISP / , http: / / crispr.mit.edu / etc.) to design the corresponding sgRNA, which will not be repeated here. The sgRNA was cloned into the pLX-sgRNA vector (addgene #50662), packaged with lentivirus, infected the TRE-dCas9-VPR and TRE-dCas9-KRAB cells prepared in Example 1, and added Blasticidin (4 μg / ml) for screening two days later. Add doxycycline at a final concentration of 500ng / ml to the surviving cells after 4-6 days of screening, and after incubation for 48 hours, detect the mRNA expression level of the corresponding target gene relative to Nkx2.5 in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides inducible CRISPRon or CRISPRi mouse embryo stem cells and a preparation method thereof. The mouse embryo stem cells are A2Lox.Cre cells and can reversibly express dCas9-VPR fusion protein or dCas9-KRAB fusion protein. The invention further provides a method for regulating and controlling gene expression and a kit. According to the inducible CRISPRon or CRISPRi mouse embryo stem cells provided by the invention, the construction method is simple and convenient, and the stable positive rate is up to 90 percent or higher; the genomic sequence is not edited, and gene expression is directly activated or inhibited; expression of the fusion protein has inducibility and reversibility; controllability and diversity on targeted regulation and control on the gene are achieved.

Description

technical field [0001] The invention relates to the field of gene expression regulation, in particular to an inducible CRISPRon and CRISPRi mouse embryonic stem cell and its application. Background technique [0002] RNA interference (RNAi) or gene overexpression (overexpression, OE) is a common method for gene function research. However, RNAi is a post-transcriptional regulation and is prone to off-target phenomena; overexpression (OE) often uses the promoter of the cloning vector to promote the expression of foreign genes, and the activity of the promoter is unstable and uncontrollable in different cell types. [0003] The combination of regularly clustered interspaced short palindromic repeats CRISPR and endonuclease Cas9 can target and cut the DNA genetic material of invaders under the guidance of guide RNA (sgRNA). In 2012, researchers took advantage of this feature to make the CRISPR system into a powerful genome editing tool (Jinek, M. et al., 2012; Cong, L. et al., ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/867C12N15/62
CPCC07K14/4703C07K2319/00C12N5/0606C12N9/22C12N15/86C12N2740/15043C12N2800/107C12N2800/80
Inventor 吴旭东李睿
Owner TIANJIN MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com