Kit for joint detection on dengue fever virus and chikungunya virus on basis of fluorescent PCR method
A technology of dengue virus and chikungunya, which is applied in the field of kits for combined detection of dengue virus and chikungunya virus based on fluorescent PCR method, can solve problems such as trouble and waste of cost, avoid mutual interference and ensure accuracy Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Design and synthesis of detection primers and probes of dengue virus and chikungunya virus nucleic acid joint detection kit (fluorescent PCR method):
[0040] Synthesize specific primers for dengue virus, dengue virus probes, specific primers for chikungunya viruses and chikungunya virus probes according to SEQ ID No.1-6, and label at the 5' of the dengue virus probes FAM fluorescent group, the 5'-labeled HEX fluorescent group of the Chikungunya virus probe, and the 3' end of both are labeled with BHQ1, and the primer probes for dengue fever and Chikungunya were synthesized. The primers and probe sequences are as follows :
[0041] Dengue virus:
[0042] Upstream primer: AGGACTAGAGGTTAGWGG (SEQ ID No.1)
[0043] Downstream primer: CAGCACCATTCCATTTTC (SEQ ID No.2)
[0044] Probe: 5' fluorescent reporter group-tccCagCgtCaaTatg-BHQ13' (SEQ ID No.5)
[0045] Chikungunya virus:
[0046] Upstream primer: ACTCAACCATCCTGGAYA (SEQ ID No.3)
[0047] Downstream primer: GAGTC...
Embodiment 2
[0052] Preparation of detection mixture of dengue virus and chikungunya virus nucleic acid joint detection kit (fluorescent PCR method):
[0053] Dengue virus upstream primer 0.5 μl / test; downstream primer 0.5 μl / test; probe 0.1 μl / test; chikungunya virus upstream primer 0.5 μl / test; downstream primer 0.5 μl / test; probe 0.1 μl / test; Internal control probe 0.1μl / test; primer concentration 20μM, probe concentration 10μM; RT-PCR MIX 12.5μl / test (OneStep RT-PCR Kit, QIAGEN); process water (ddH 2 O) Mix 3.2 μl / test to get the D&C nucleic acid fluorescent PCR detection mixture.
Embodiment 3
[0055] Sensitivity Analysis of Dengue Virus and Chikungunya Virus Nucleic Acid Joint Detection Kit (Fluorescent PCR Method):
[0056] 3.1 Sample preparation:
[0057] Take 1×10 7 Dengue virus plasmid (DFV-S1) of copies / ml (cloning the target amplified sequence to the pMD8-T vector by TA to obtain the DFV-S1 plasmid. The target amplified sequence: AAACAGCATATTGACGCTGGGAGAGACCAGAGATCCTGCTGTCTCTACAAGCATCATTCCAGGCACAGAACGCCA) (SEQ ID No.8), Diluted at 1:10, 1:100, 1:1000, 1:10000 to obtain DFV-S2 (1×10 6 copies / ml), DFV-S3 (1×10 5 copies / ml), DFV-S4 (1×10 4 copies / ml), DFV-S5 (1×10 3 copies / ml) were used as test samples.
[0058] Take 1×10 7 Chikungunya virus plasmid (CHIKV-S1) of copies / ml (cloning the target amplified sequence onto the pMD8-T vector by TA to obtain the CHIKV-S1 plasmid. Target amplified sequence: GAATGACCATGCTAATGCTAGAGCGTTCTCGCATCTAGCTATAAAACTAATAGAGCAGGAAATTGACCCCGACTCAACCATCCTGGATATCGGCAGTGCGCCAGCAAGGAGGATGATGTCGG) (SEQ ID No. 9), according to 1:10, 1:...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com