Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

NLR gene NLR1-V, expression vector thereof and application of NLR gene NLR1-V and expression vector thereof

An expression vector and gene-like technology, applied in the field of genetic engineering, can solve problems such as rapid virulence variation, agricultural production disasters, outbreaks of wheat powdery mildew, etc., and achieve the effect of improving resistance

Active Publication Date: 2017-05-31
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the large number of physiological races of wheat powdery mildew and rapid virulence variation, once a new toxic race is produced or the population of the race changes, it will lead to a large outbreak of wheat powdery mildew and bring disastrous consequences to agricultural production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • NLR gene NLR1-V, expression vector thereof and application of NLR gene NLR1-V and expression vector thereof
  • NLR gene NLR1-V, expression vector thereof and application of NLR gene NLR1-V and expression vector thereof
  • NLR gene NLR1-V, expression vector thereof and application of NLR gene NLR1-V and expression vector thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1 Cloning of an NLR-like gene NLR1-V in the translocation line 6VS / 6AL Nannong 9918 of wheat-P.

[0019] The Wheat-Glutella pilosa translocation line 6VS / 6AL Nannong 9918 is a wheat variety containing the broad-spectrum powdery mildew resistance gene Pm21 bred by the Institute of Cytogenetics of Nanjing Agricultural University (Gongzhi Gonggong, Chen Peidu, Zhang Shouzhong, Wang Xiu'e, Wang Suling, Zhou Bo, Feng Yi Gao, Liu Dajun. Nannong 9918, a new wheat variety resistant to powdery mildew and high yield. Journal of Nanjing Agricultural University, 2002,25(4):1438-1444). In the early stage, multiple 6VS transformation sequences have been developed on the 6VS of Nannong 9918, and the small fragment insertion translocation line NAU418 was further used to limit Pm21 between 6EST258 and CINAU15, and there are two 6EST243 and 6EST238 in the chromosome interval where Pm21 is located Marker (known and public, Radiation-induced translocations with reduced Haynaldia vi...

Embodiment 2

[0022] Example 2 The NLR gene NLR1-V was induced and expressed by powdery mildew in the wheat-P. villosa translocation 6VS / 6AL Nannong 9918

[0023] Using the cDNA samples of the wheat-T. villosa translocation line 6VS / 6AL Nannong 9918 induced by powdery mildew for different periods of time as templates, primers P3 (ACGGGCTTATTCCAAGTCCT, SEQ ID NO.5) and P4 (ACGCTTCTGAAGGCAGACTC , SEQ ID NO.6) was used as primer for Q-PCR analysis. The PCR program is as follows: the PCR reaction is amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad Company, USA) and the fluorescence is detected. The 20uL PCR reaction system contains 10uL of 2×SYBR Green PCR Master Mix, 0.5μM primers P3 and P4, and 2uL of reverse transcription cDNA template. The amplification parameters were: 95°C for 10 minutes, then 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 1 minute, a total of 40 cycles. After the reaction, the measurement of the melting curve was carried out. The...

Embodiment 3

[0024] The construction of embodiment 3NLR1-V gene transient expression vector

[0025] Using the NLR1-V gene cDNA cloned in Nannong 9918 induced by powdery mildew as a template, the primer pair NLR1-V-BamHI-F (GGAGAGAACACGGGGGATCCATGTCTGCACCGGTCGTCAG, SEQ ID NO.7) and NLR1-V-StuI-R (AACGTCGTATGGGGTAAGGCCTTTAAAGTAAAACTGGGACCACATTCATAG, SEQ ID NO.8) was amplified by PCR, and the amplified fragment was recovered. The amplified product was double digested with BamHI and StuI, and the digested product was inserted into the vector pBI220 (Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higherplants.EMBO J.1987,6:3901-3907.), NLR1-V was placed at the multiple cloning site behind the 35S promoter. Thus, the target gene NLR1-V is cloned to the downstream of the strong promoter 35S to obtain the expression vector pBI220:NLR1-V ( figure 1 ). It was verified by sequencing that the vector was constructed successful...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering and discloses an NLR gene NLR1-V, an expression vector thereof and application of the NLR gene NLR1-V and the expression vector thereof. A cDNA sequence of the gene NLR1-V with an NLR structural domain is SEQ ID NO.1, and an amino acid sequence encoded by the gene is SEQ ID NO.2. The gene comes from a 6VS chromosome arm of a wheat-haynaldia villosa translocation line 6VS / 6AL Nannong 9918. Inducible expression of NLR1-V by powdery mildew in the powdery mildew resisting wheat variety Nannong 9918 is enhanced. The gene is converted into a susceptible wheat variety Yangmai 158 through transient expression, and the result shows that overexpression of NLR1-V can reduce the haustorium index of the Yangmai 158. Thus, NLR1-V is expected to be used for gene engineering breeding and is expected to improve the powdery mildew resistance of the wheat when introduced to the powdery mildew susceptible wheat variety.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and discloses an NLR gene NLR1-V in the translocation line 6VS / 6AL Nannong 9918 of wheat-P. Background technique [0002] The whole growth period of wheat (Triticum aestivum) is harmed by various diseases and insect pests, among which the wheat powdery mildew caused by the infection of wheat powdery mildew (Blurmeria graminis f.sp.tritici, Bgt) is one of the most serious fungal diseases of wheat. Because wheat powdery mildew has many physiological races and rapid virulence variation, once a new toxic race is produced or the population of the race changes, it will lead to a large outbreak of wheat powdery mildew and bring disastrous consequences to agricultural production. The discovery and utilization of broad-spectrum and long-lasting disease resistance genes are of great significance to the control of powdery mildew. [0003] The powdery mildew resistance gene Pm21 carried by wheat tufts (Ha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00
CPCC12N15/8282C07K14/415C12N15/8218
Inventor 邢莉萍曹爱忠胡平刘佳倩崔超凡曹姝琪张瑞奇张守忠陈佩度
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More