Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer group for identifying mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotracheitis virus and application thereof

A technique for rhinotracheitis virus and bovine viral diarrhea, which is applied to a primer set for identifying Mycoplasma bovis, bovine viral diarrhea virus and bovine infectious rhinotracheitis virus and its application field, and can solve the problem of indistinguishable, mixed infection, economic loss, etc.

Active Publication Date: 2017-05-31
GUANGXI VETERINARY RES INST
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] All three pathogens can cause bovine respiratory diseases. The clinical symptoms are similar and difficult to distinguish, and they often exist in the form of mixed infection. After infection, they will cause serious economic losses.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group for identifying mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotracheitis virus and application thereof
  • Primer group for identifying mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotracheitis virus and application thereof
  • Primer group for identifying mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotracheitis virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Embodiment 1, the design of primer

[0078] Sequence analysis was performed on the genomic DNA of Mycoplasma bovis, the DNA corresponding to the total RNA of bovine viral diarrhea virus, and the genomic DNA of bovine infectious rhinotracheitis virus. Based on the sequence analysis, target sites were selected and primers were designed, and thousands of A primer pair library consisting of primer pairs. Preliminary experiments were performed on each primer pair in the primer pair library to test the sensitivity, specificity and universality of the primer pairs, and finally the primer pair A for identifying Mycoplasma bovis and the primer pair A for identifying bovine viral diarrhea virus were obtained. Primer pair B and primer pair C for the identification of bovine infectious rhinotracheitis virus.

[0079] Primer pair A consists of the following primers F1 and R1 (5'→3'):

[0080] F1 (sequence 1 of the sequence listing): GCAACATGAAACCTTATACGA;

[0081] R1 (Sequence 2 ...

Embodiment 2

[0089] Embodiment 2, parameter optimization

[0090] Primer pair A, primer pair B and primer pair C were optimized for triple two-temperature PCR. The parameters to be optimized include parameters of the reaction system and parameters of the reaction program. The parameters of the reaction system include (25 μL): in the initial reaction system, the content of AMV reverse transcriptase, MgCl 2 The concentration of Taq DNA Polymerase, the concentration of dNTP, and the concentration of each primer. Parameters of the reaction program include: annealing extension temperature.

[0091] The recommended initial reaction system is (25 μL): AMV reverse transcriptase 1~5U, MgCl 2 1~10mmol / L, Taq DNA Polymerase 1~5U, dNTP 0.1~0.8mmol / L, each primer 1~10pmol / μL. The optimal initial reaction system is (25μL): AMV reverse transcriptase 5U, MgCl 2 1.5mmol / L, Taq DNA Polymerase 2.5U, dNTP 0.2mmol / L, primer F1 1pmol / μL, primer R1 1pmol / μL, primer F2 1pmol / μL, primer R2 1pmol / μL, primer ...

Embodiment 3

[0093] Embodiment 3, establishment of method

[0094] 1. Use the RNA / DNA co-extraction kit to extract the nucleic acid of the sample to be tested.

[0095] 2. Take the nucleic acid obtained in step 1 as a template and perform triple two-temperature PCR.

[0096] The initial reaction system is (25μL) AMV reverse transcriptase 5U, MgCl 2 1.5mmol / L, Taq DNA Polymerase2.5U, dNTP 0.2mmol / L, Primer F1 1pmol / μL, Primer R1 1pmol / μL, Primer F2 1pmol / μL, Primer R2 1pmol / μL, Primer F3 1pmol / μL, Primer R3 1pmol / μL μL, 2.5 μL of 10×buffer, 1 μL of template, and water as the balance.

[0097] The reaction program is: 42°C for 30 minutes; 94°C for 5 minutes; 94°C for 30s, 67°C for 30s, 35 cycles; 72°C for 10 minutes.

[0098] 3. Take the product of step 2 and perform 1% agarose gel electrophoresis.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer group for identifying a mycoplasma bovis, a bovine viral diarrhea virus and an infectious bovine rhinotracheitis virus and an application thereof. According to the invention, a primer composition formed by a primer pair A, a primer pair B and a primer pair C is protected. The primer pair A is formed by a primer F1 as shown in a sequence 1 and a primer R1 as shown in a sequence 2; the primer pair B is formed by a primer F2 as shown in a sequence 3 and a primer R2 as shown in a sequence 4; and the primer pair C is formed by a primer F3 as shown in a sequence 5 and a primer R3 as shown in a sequence 6. By adopting the primer pair A, the primer pair B and the primer pair C, the mycoplasma bovis, the bovine viral diarrhea virus and the infectious bovine rhinotracheitis virus are detected through triple two-temperature PCR, and the primer group has the advantages of being good in specificity, high in sensitivity, good in universality, convenient and fast, and can be used for clinical differential diagnosis and epidemiological investigation. A novel technique is provided for prevention and control of cattle diseases, and the primer group has very high clinical application value.

Description

technical field [0001] The invention relates to a primer set for identifying bovine mycoplasma, bovine viral diarrhea virus and bovine infectious rhinotracheitis virus and its application. Background technique [0002] Bovine respiratory disease complex (BRD) is one of the most serious diseases that harm the cattle industry, restricting the development of the global cattle industry all the time. Bovine respiratory syndrome mainly harms calves, beef cattle and dairy cattle. It has the characteristics of high morbidity and mortality, and causes heavy economic losses to the cattle industry. Bovine respiratory syndrome is usually caused by one or several pathogens alone or mixed infection, Mycoplasma bovis (MB), bovine viral diarrhea virus (Bovine viral diarrhea, BVDV) and bovine infectious rhinotracheitis virus (bovine herpesvirus Ⅰ , IBRV) are the most common three major pathogens of bovine respiratory syndrome. [0003] Mycoplasma bovis can cause calf pneumonia, mastitis, k...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/70C12Q1/68C12Q1/04
CPCC12Q1/689C12Q1/701C12Q2600/16
Inventor 谢芝勋范晴谢志勤谢丽基黄莉黄娇玲张艳芳曾婷婷王盛罗思思邓显文刘加波庞耀珊
Owner GUANGXI VETERINARY RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com