Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method and applications of bacillus subtilis with high yield of glucosamine

A technology of Bacillus subtilis and glucosamine, which is applied in the field of bioengineering and can solve the problems of less research, high cost, and low yield

Active Publication Date: 2017-05-10
QILU UNIV OF TECH +1
View PDF7 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The genetically engineered bacterium forms a complete metabolic pathway from glucose to N-acetylglucosamine by expressing the gene encoding glucosamine 6-phosphate synthase and acetylase 6-phosphate in Bacillus subtilis; Glucosamine 6-phosphate deaminase gene nagB and gamA, 6-phosphate-N-acetylglucosamine deacetylase gene nagA, glucosamine transporter gene gamP and The N-acetylglucosamine transporter gene nagP is constructed, which solves the problems of poor safety, low yield and high cost of N-acetylglucosamine produced in the prior art
However, it cannot solve the problem of real-time detection of changes in glucosamine during the fermentation process
[0004] The glms riboswitch is the only riboswitch found so far that can regulate sugar metabolism. It only exists in Gram-positive bacteria and is located in the 5'UTR of the mRNA encoding glmS. It needs the small molecule substance GlcN-6P to activate it. It is very rare among the ribozymes that have been discovered, and there are few related studies on the glms riboswitch

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and applications of bacillus subtilis with high yield of glucosamine
  • Construction method and applications of bacillus subtilis with high yield of glucosamine
  • Construction method and applications of bacillus subtilis with high yield of glucosamine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] A method for constructing a high-yield glucosamine subtilis bacillus, the steps are as follows:

[0079] (1) Extract the plasmid pEGFP-N1 in Escherichia coli, use the plasmid pEGFP-N1 as a template, use primers EGFP-F and EGFP-R to carry out PCR amplification, and make EGFP enhanced fluorescent protein coding gene; EGFP enhanced fluorescent protein The nucleotide sequence of the coding gene is shown in SEQ ID NO.2; the nucleotide sequence of the primer is as follows:

[0080] EGFP-F:CTTCTTTTTAATGGTGAGCAAGGGCGAGGA;

[0081] EGFP-R:TCTAGATTACTTGTACAGCTCGTCCA;

[0082] The PCR amplification system is as follows, the total system is 50 μl:

[0083] 2×HiFi-PCR master 25 μl, primer EGFP-F 2 μl concentration 10 μmol / L, primer EGFP-R 2 μl concentration 10 μmol / L, template 2 μl, ddH 2 O make up 50 μl;

[0084] The PCR amplification procedure is as follows:

[0085] Pre-denaturation at 95°C for 5min; denaturation at 95°C for 30sec, annealing at 51°C for 30sec, extension at 7...

Embodiment 2

[0126] The application of high-yield glucosamine subtilis in fermentative production of glucosamine, the steps are as follows:

[0127] 1) Pick a single colony of high-yielding glucosamine-producing Bacillus subtilis from an LB plate containing 25 μg / mL of chloramphenicol and transfer it to 3 mL of LB liquid medium, and culture overnight at 37° C. and 200 rpm to obtain a seed solution;

[0128] The components per liter of LB flat plate are as follows:

[0129] Tryptone 10g, yeast extract 5g, NaCl 10g, agar powder 15g, water to 1L, pH 7.0.

[0130] The composition of LB liquid medium per liter is as follows:

[0131] Tryptone 10g, yeast extract 5g, NaCl 10g, water to 1L, pH 7.0.

[0132] 2) The seed solution was inoculated in 100 mL LB liquid medium containing chloramphenicol 25 μg / mL, cultured at 37° C. and 200 rpm, and the expression was induced according to the conditions in Table 1, respectively.

[0133] Table 1 Orthogonal experiment table for optimization of Bacillus s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method and applications of bacillus subtilis with high yield of glucosamine. The construction method comprises the following steps: transforming a GFA1 gene coming from a brewer's yeast, a glms riboswitch gene and an EGFP enhanced fluorescent protein coding gene into bacillus subtilis, and carrying out construction to obtain bacillus subtilis with high yield of glucosamine. According to the invention, for the first time, the glms riboswitch gene and the EGFP gene are connected into PHT01, then a GLMS-EGFP sensor is constructed, the change of fluorescence intensity is shown by responding to the change of the amount of glucosamine 6-phosphate in bacillus subtilis cells, and through a flow cytometry, the synthesis condition of glucosamine can be known in real time.

Description

technical field [0001] The invention relates to a construction method and application of a high-yielding glucosamine-yielding Bacillus subtilis, in particular to a method and application of a high-yielding glucosamine-yielding Bacillus subtilis using a glms riboswitch, and belongs to the technical field of bioengineering. Background technique [0002] Glucosamine (GlcN) is an amino monosaccharide naturally present in connective tissue and gastrointestinal mucosa. Endogenous GlcN is converted from glucose in animal and human cells and can synthesize mucopolysaccharides, glycoproteins, and proteoglycans. , especially the intermediates for synthesizing articular cartilage and synovial fluid molecules. Clinical trials have shown that exogenous ammonia sugar has a good curative effect on osteoarthritis in humans and animals, and also has physiological functions such as anti-tumor activity. At present, almost all commercialized GlcN comes from high-temperature hydrolysis of shell ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/75C12P19/26C12R1/125
Inventor 李丕武郝李振王瑞明
Owner QILU UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com