Construction method and application of a glucosamine-producing Bacillus subtilis
A technology of Bacillus subtilis and glucosamine, applied in the field of bioengineering, can solve the problems of low yield, poor safety of N-acetylglucosamine and high cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0078] A construction method for producing glucosamine subtilis, the steps are as follows:
[0079] (1) Extract the plasmid pEGFP-N1 in Escherichia coli, use the plasmid pEGFP-N1 as a template, use primers EGFP-F and EGFP-R to carry out PCR amplification, and make EGFP enhanced fluorescent protein coding gene; EGFP enhanced fluorescent protein The nucleotide sequence of the coding gene is shown in SEQ ID NO.2; the nucleotide sequence of the primer is as follows:
[0080] EGFP-F:CTTCTTTTTAATGGTGAGCAAGGGCGAGGA;
[0081] EGFP-R:TCTAGATTACTTGTACAGCTCGTCCA;
[0082] The PCR amplification system is as follows, the total system is 50 μl:
[0083] 2×HiFi-PCR master 25 μl, primer EGFP-F 2 μl concentration 10 μmol / L, primer EGFP-R 2 μl concentration 10 μmol / L, template 2 μl, ddH 2 O make up 50 μl;
[0084] The PCR amplification procedure is as follows:
[0085] Pre-denaturation at 95°C for 5min; denaturation at 95°C for 30sec, annealing at 51°C for 30sec, extension at 72°C for 1.5m...
Embodiment 2
[0126] The application of glucosamine-producing Bacillus subtilis in fermentative production of glucosamine, the steps are as follows:
[0127] 1) Pick a single colony of glucosamine-producing Bacillus subtilis from an LB plate containing 25 μg / mL of chloramphenicol and transfer it to 3 mL of LB liquid medium, and culture overnight at 37° C. and 200 rpm to obtain a seed solution;
[0128] The components per liter of LB flat plate are as follows:
[0129] Tryptone 10g, yeast extract 5g, NaCl 10g, agar powder 15g, water to 1L, pH 7.0.
[0130] The composition of LB liquid medium per liter is as follows:
[0131] Tryptone 10g, yeast extract 5g, NaCl 10g, water to 1L, pH 7.0.
[0132] 2) The seed solution was inoculated in 100 mL LB liquid medium containing chloramphenicol 25 μg / mL, cultured at 37° C. and 200 rpm, and the expression was induced according to the conditions in Table 1, respectively.
[0133] Table 1 Orthogonal experiment table for optimization of Bacillus subtili...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com