Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker for rice seed peel color gene Pb and application of molecular marker

A color gene and molecular marker technology, applied in the field of plant biology, can solve the problems of time-consuming detection, high cost, cumbersome CAPS labeling operation, etc., and achieve the effects of fast typing, easy operation, and short amplification fragments

Inactive Publication Date: 2016-10-12
HAINAN BOLIAN RICE GENE TECH CO LTD
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although CAPSRa and CAPSPb markers have greatly improved the selection efficiency of purple rice varieties, the shortcomings of CAPS markers, such as cumbersome operation, time-consuming detection, and high cost, are not conducive to the large-scale application of such markers in breeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for rice seed peel color gene Pb and application of molecular marker
  • Molecular marker for rice seed peel color gene Pb and application of molecular marker
  • Molecular marker for rice seed peel color gene Pb and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Primer Design and Amplified Fragment Analysis of Rice Pb Gene Molecular Marker

[0038] 1. Primer design

[0039] Through the sequence alignment of rice pericarp color gene Pb alleles in purple and white pericarp varieties, the GT deletion site in exon 7 of Pb in purple and white pericarp varieties was analyzed. Design the primer combination according to the sequence upstream and downstream of the GT deletion site:

[0040] PbF:AGCGACGACGACACCGACG, (SEQ ID NO.1)

[0041] PbR1: ATGCCTGCACCGAGAGGATCCA, (SEQ ID NO. 2) and

[0042] PbR2: GTTGATGCCTGCACCGAGAGGACAT (SEQ ID NO.3) (see figure 1 ).

[0043] 2. Analysis of amplified fragments

[0044] When the above primer combination is used to amplify the rice peel color gene Pb, a 173bp band, or a 173bp and a 179bp band can be amplified simultaneously from the purple peel material (with GT deletion genotype Pb). A 179bp band will be amplified from the white peel material (with wild genotype Pb). The nucleotide...

Embodiment 2

[0045] Embodiment 2 identifies the Pb genotype of rice varieties / lines with molecular markers of the present invention

[0046] 1. Identification method of rice peel color

[0047] Remove the chaff with a brown rice machine, observe and record the color of the peel of the brown rice with the naked eye.

[0048] 2. Extraction of rice genomic DNA

[0049] Heibaonuo, Zhonghaixiang 1, Xiangwanxian 12, 70489, 71647, 70363, 71536, Guanghong 2, w10, w12, w13, Buxuenuo, K13135, Guangye 188, F13108-4, etc. 15 Rice varieties / strains are used as materials, and rice genomic DNA is extracted by the CTAB method. The specific steps are as follows: take 3 cm long rice leaves, and extract them in 800 μL of extraction buffer [1.5% (w / v) CTAB, 1.05mol / L NaCl, 75mmol / L Tris-HCl (pH 8.0), 15mmol / L EDTA (pH 8.0)] and collected into a 1.5mL centrifuge tube. Water bath at 65°C for 30 minutes, and mix by inverting occasionally. Add 800 μL of chloroform:isoamyl alcohol (volume ratio 24:1), and mix...

Embodiment 3

[0057] Embodiment 3 Application of molecular markers of the present invention

[0058] 1. Rice materials F of rice varieties Heibaonuo and Zhonghaixiang 1 2 Generation of 61 individual plants.

[0059] 2. Extraction of Genomic DNA of Rice Genomic DNA of leaves was extracted at the seedling stage, and the specific method was the same as in Example 2.

[0060] 3. Refer to Example 2 for PCR amplification and product judgment criteria.

[0061] 4. Refer to Example 2 for the identification method of rice peel color.

[0062] 5. Results and analysis The molecular markers of Example 1 of the present invention (specific primer combination PbF, PbR1, and PbR2 obtained by PCR amplification) were used to detect 61 F in Heibaonuo and Zhonghaixiang No. 1 at the seedling stage. 2 The genotype of Pb in the offspring individual plants, found that 12 individual plants only amplified the 179bp band, 16 individual plants only amplified the 173bp band, and 33 individual plants simultaneously a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a molecular marker and application of a rice peel color gene Pb, belonging to the field of plant biotechnology. The molecular marker of the present invention is obtained by PCR amplification of one forward primer and two reverse primers, and the nucleotide sequences of the aforementioned primers are respectively shown in SEQ ID NO.1-3. Using the molecular marker of the rice pericarp color gene Pb, the genotyping of the rice pericarp color gene Pb can be completed by simple PCR, and the rice pericarp color can be predicted. The invention has the advantages of simple operation, rapid typing, low cost and the like, and is more suitable for use in large-scale molecular marker-assisted selection.

Description

technical field [0001] The invention belongs to the field of plant biotechnology, and in particular relates to a molecular marker of rice peel color gene Pb and its application. Background technique [0002] Rice is one of the most important food crops in my country, and more than half of the country's population uses rice as a staple food. With the development of social economy, people's requirements for dietary nutritional quality are gradually increasing, and the nutritional quality of rice has also received more and more attention. Purple rice is a kind of colored rice with high nutritional value. Compared with ordinary white rice that does not contain anthocyanins, a large amount of anthocyanins, including cyanidin-3-glucoside and paeoniflorin-3-glucoside, are accumulated in the peel of purple rice, making brown rice purple or black . Anthocyanins belong to flavonoid substances, which have strong antioxidative effect and can effectively scavenge active oxygen free ra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/158
Inventor 黄培劲龙湍唐杰李佳林吴永忠
Owner HAINAN BOLIAN RICE GENE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com