Supercharge Your Innovation With Domain-Expert AI Agents!

CpG nucleic acid medicine conveying system with pH response and preparation method thereof

A nucleic acid drug and delivery system technology, which can be applied to medical preparations with non-active ingredients, medical preparations containing active ingredients, and drug combinations, etc. Effects of uptake, enhanced immune response, controlled release

Inactive Publication Date: 2016-09-21
UNIV OF SHANGHAI FOR SCI & TECH
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Because the chemical nature of CpG ODN is a deoxynucleotide, it is easily decomposed by deoxynucleotidase, has poor stability in serum, and has a low cellular uptake rate, so its application is limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CpG nucleic acid medicine conveying system with pH response and preparation method thereof
  • CpG nucleic acid medicine conveying system with pH response and preparation method thereof
  • CpG nucleic acid medicine conveying system with pH response and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The first embodiment is a preparation experiment of the pH-responsive CpG nucleic acid drug delivery system provided by the present invention.

[0041] In this embodiment, the CpG nucleic acid drug used is a CpG oligodeoxynucleotide modified with a 5' terminal amino group containing 72 base pairs, and its sequence is:

[0042] 5'-NH2-(CH2) 6 - TCAGAGAGTTAGAGAGTTAGAGAGTCAGAGAGTTAGAGAGTTAGAGAGTCAGAGAGTTAGAGAGTTAGAGAG-3'.

[0043] In this embodiment, the aldehyde-based silane coupling agent used is triethoxysilyl n-butyraldehyde silane, the silicon source is tetraethyl orthosilicate, and the surfactant is cetyltrimethylammonium bromide. The cosolvent is triethanolamine, and the buffer is phosphate buffer at pH 8.1.

[0044] The preparation steps of the pH-responsive CpG nucleic acid drug delivery system provided by the present invention are as follows:

[0045] Step 1: Add 1g of cetyltrimethylammonium bromide and 0.18g of triethanolamine into 60mL of deionized water, ke...

Embodiment 2

[0063] The carrier particles prepared in Example 1 were used for cytotoxicity measurement, and the standard CellCounting Kit-8 method was used for the measurement method. In this example, the macrophage cell line RAW264.7 was purchased from Riken, Japan, and cultured according to the method provided by the supplier.

[0064] The specific experimental process is as follows:

[0065] The carrier particles prepared in Example 1 were dispersed in MEM medium and formulated into a suspension with a concentration of 1 mg / mL. After the RAW264.7 cells were seeded in a 96-well plate (the cell density was 5000 cells / well), the above-mentioned Suspensions of carrier particles were added to 96-well plates at final concentrations of 0, 25, 50, 75, 100 and 200 μg / mL, respectively, and the solution volume was 100 μL.

[0066] Five different concentrations of carrier particle suspensions and the blank control group without carrier particles were co-cultured with the cells for 24 hours, and th...

Embodiment 3

[0072] In this example, a fluorescent labeling method was used to conduct a cell uptake experiment on the CpG nucleic acid drug delivery system prepared according to the method provided in Example 1.

[0073] In this example, the fluorescent marker FITC is used to modify the CpG nucleic acid drug in Example 1 to obtain the FITC-modified CpG nucleic acid drug. Then use the FITC-modified CpG nucleic acid drug as a CpG nucleic acid drug, and prepare a FITC-modified CpG nucleic acid drug delivery system according to the preparation method provided in Example 1.

[0074] will be 1.5×10 4 RAW264.7 cells were seeded in a 35mm glass-bottom culture dish, and after 24 hours of culture, the FITC-modified CpG nucleic acid drug delivery system was added to the culture dish with a final concentration of 100 μg / mL. After 4 hours, the cells were washed twice with buffer and fixed with 4% (mass percent) formaldehyde solution for 10 minutes; Cells were treated at room temperature for 10 minut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
pore sizeaaaaaaaaaa
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a CpG nucleic acid medicine conveying system. The CpG nucleic acid medicine conveying system comprises a carrier and a CpG nucleic acid medicine, and is characterized in that the carrier is an aldehyde group silane coupling agent modified mesoporous silica nano grain; the CpG nucleic acid medicine is 5' terminal amino modified CpG oligonucleotide; the carrier and the CpG nucleic acid medicine are in covalent linkage through an imine linkage; and the imine linkage has pH sensitivity. The invention further provides a preparation method of the CpG nucleic acid medicine conveying system. According to the CpG nucleic acid medicine conveying system provided by the invention, the carrier and the CpG nucleic acid medicine are in covalent linkage through the pH sensitive imine linkage and can reach a lysosome after being absorbed by immune cells; and the free CpG nucleic acid medicine is released under a weak acidic condition of the lysosome, so that the immune cells are induced to secrete a series of cell factors. The CpG nucleic acid medicine conveying system can realize controllable release of the CpG nucleic acid medicine and has high secretion induction efficiency.

Description

technical field [0001] The invention relates to a drug delivery system, in particular to a pH-responsive CpG nucleic acid drug delivery system and a preparation method thereof. Background technique [0002] CpG oligonucleotide (hereinafter referred to as CpG ODN) is an oligonucleotide containing a CpG (cytosine-phosphate-guanine) motif, which can be detected by Toll-like receptor-9 (hereinafter referred to as TLR-9) in cells. ) recognizes and induces immune cells to secrete a series of cytokines including interleukin-6 (hereinafter referred to as IL-6), thereby inducing and enhancing the immune response, so it can be used as an immune adjuvant for the preparation of immune adjuvants in some infectious diseases It has important application prospects in the prevention and treatment of diseases such as allergic diseases and tumors. [0003] Because the chemical nature of CpG ODN is a deoxynucleotide, it is easily decomposed by deoxynucleotidase, has poor stability in serum, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K47/48A61K31/7084A61P37/08A61P35/00A61P31/00
CPCA61K31/7084
Inventor 朱钰方徐怡
Owner UNIV OF SHANGHAI FOR SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More