Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primers, probe, kit and method for detecting bovine coronavirus

A coronavirus and kit technology, applied in the field of molecular biology, can solve the problems of not being able to explain whether there is bovine coronavirus in cattle, not being able to detect bovine coronavirus in a timely and accurate manner, and not being able to well meet the needs of pathogenic detection, etc. To achieve the effect of simple and practical operation, high specificity and sensitivity, and strong specificity

Inactive Publication Date: 2016-06-15
WENS FOOD GRP CO LTD
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Existing method has following shortcoming: (1) Elisa antibody detection method: the premise of this method is that cattle are infected with bovine coronavirus and produce antibody, because it needs a certain time from infecting virus to producing antibody, the detection of virus is limited in time. Due to certain limitations, bovine coronavirus cannot be detected in time and accurately; in addition, for cattle that have been immunized with bovine coronavirus vaccine, or have been infected with bovine coronavirus before, the subsequent antibodies will persist for a certain period of time, even if there is no virus in the body of the cattle Antibodies can also be detected when a cow is infected, and a positive antibody test result does not indicate the presence or absence of bovine coronavirus in the cow
(2) Virus isolation and purification method: This method is a classic etiological diagnosis method, but it is time-consuming and laborious to operate. The isolation and cultivation of bovine coronavirus is generally difficult, especially the initial isolation and cultivation
Therefore, the virus isolation and purification method cannot well meet the needs of rapid and effective pathogenic detection in modern farming.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers, probe, kit and method for detecting bovine coronavirus
  • Primers, probe, kit and method for detecting bovine coronavirus
  • Primers, probe, kit and method for detecting bovine coronavirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 detects primers, probes and methods for bovine coronavirus

[0028] 1, Primer and Probe Design

[0029] Target fragment amplification: According to the bovine coronavirus N gene sequence (GB︱EU401981.1︱) published by GenBank, design quantitative PCR amplification primers, and design probe primers in the middle of the designed amplification primers, and quantitative PCR primers And the probe was synthesized by Shanghai Jikang Biotechnology Co., Ltd., the sequence is as follows:

[0030] Upstream primer: TCCTTAAGTGGGCCGATCAG (SEQ ID NO: 1)

[0031] Downstream primer: GAGCTTCTTTCACCCCTGGTTTG (SEQ ID NO: 2)

[0032] Probe: 5'FAM-CCGACCAATCTAGAAAT-3'TAMRA (SEQ ID NO:3)

[0033] The 3' end of the probe P is bound to the fluorescent quenching group TAMRA, and the 5' end of the probe P is bound to the fluorescent reporter group FAM.

[0034] 2, Detection method

[0035] Include the following steps:

[0036] (1) Extraction of sample RNA

[0037] Positive con...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers, a probe, a kit and a method for detecting bovine coronavirus. The primers are disclosed as SEQ ID NO:1 and SEQ ID NO:2, and the probe is disclosed as SEQ ID NO:3. The method comprises the following steps: by using cDNA (complementary deoxyribonucleic acid) obtained by carrying out RNA (ribonucleic acid) reverse transcription on the detected sample as a template, carrying out fluorescent quantitative PCR (polymerase chain reaction) amplification, and comparing the amplification curve CT value. The quantitative PCR primers are designed at the bovine coronavirus conserved gene (N gene), and a probe process is adopted to establish a fluorescent quantitative PCR method. The primers, probe, kit and method are simple and practical to operate, have the advantages of high specificity, high sensitivity and favorable repetitiveness, and are suitable for the demands for quick and accurate detection of modernized cultivation farms.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and more specifically, the invention relates to a primer, a probe, a kit and a method for detecting bovine coronavirus. Background technique [0002] Bovine coronavirus (BCV) is one of the most important pathogens causing adult bovine winter scour and neonatal calf diarrhea (blood and mucus are often found in diarrhea stool). BCV infection is widely distributed in countries all over the world. American scientists Mebus et al. (MebusCA, StairEL, RhodesMB, et al. Pathology of neonatal calfdiarrhea induced by acoronavirus-like agent [J]. VetPathol, 1973, 10: 45-64.) detected BCV virus in the feces of sick calves and adult cattle , and then other countries in the world also reported the occurrence of the disease. Chinese scholar Song Guanglin and others (Song Guanglin, Dong Huilan, Teng Qing, et al. Research on the pathogen of calf epidemic diarrhea [J]. Journal of Animal Husbandry and Vet...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/701C12Q2521/107C12Q2563/107Y02A50/30
Inventor 卢围廖承球宋延华潘永飞宋爽王东东
Owner WENS FOOD GRP CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products