Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Identification method for conventional rice varieties Huai rice No.5 and No.18 based on InDel marks

An identification method, the technology of conventional rice, applied in the field of biological identification, can solve the problems of high error rate, variety confusion, long time period, etc., and achieve the effects of less sample consumption, good application and promotion prospects, and high accuracy

Active Publication Date: 2016-03-23
JIANGSU TIANFENG SEEDS IND CO LTD
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Huaidao 5 and Huaidao 18 have similar genetic backgrounds, which may cause variety confusion in production. The traditional morphological identification method takes a long time and has a high probability of error. It is necessary to establish a rapid identification method based on genotype

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification method for conventional rice varieties Huai rice No.5 and No.18 based on InDel marks

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: the extraction of rice DNA

[0029] Utilize the primer pair used in the invention and perform genome polymorphism analysis based on PCR amplification;

[0030] The amplification system used is: 20 μL, including 30-50 ng of template DNA, 0.25 units of DNA polymerase (Shenergy), 2.0 μL of 10× Buffer (containing Mg2+), 2.0 mMdNTPs 2 μL;

[0031] The amplification program used is: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30s, renaturation at 58°C for 30s, extension at 72°C for 30s, 32 cycles; final extension at 72°C for 7 minutes;

[0032] Electrophoresis detection: add an appropriate amount of loading buffer to the amplified product, and after 100 minutes of electrophoresis on a 12% denatured polyacrylamide gel under a constant electric field strength of 22V / cM, the color will be developed by silver staining; When the sample is combined with the aforementioned 24 pairs of primers, it can be amplified at different sites (primer pairs) ...

Embodiment 2

[0034] Example 2: Genotype Identification of Rice Varieties Huaidao 5 and Huaidao 18

[0035] Use the following primers of the present invention for the identification of rice varieties Huaidao 5 and Huaidao 18;

[0036] serial number Primer pair name Forward primer sequence (5'->3') Reverse primer sequence (5'->3') 1-1 chr01-1 gttgttcagtcaaaagtttcagc tccttatgtgaagtggaagtataac 1-2 chr01-2 atcggtagcactaaatctttcc gatagggttttaggtttttcgag 2-1 chr02-1 gtaagactagctgtttcaatcacag gtatgaggtatagacatgggagaac 2-2 chr02-2 agttgagatgaatagctagatggag aacttgaggaggatcggtatc 3-1 chr03-1 ggatcaagtagcacgataagc acctattggttgtgtgtcttgtag 3-2 chr03-2 tgtctcattcagagtatggagttc ttagattggagctatagttgaggac 4-1 chr04-1 cattgacttttcaacacattgg cataaatttccaggccatatactac 4-2 chr04-2 aacaaccgaaaggtatatgacac gaatccttaaaattgtaccgtagtg 5-1 chr05-1 gaactcttgctcttcatagaaaatg taatactcatcctctccgatcc 5-2 chr05-2 c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of creature recognition and particularly provides an identification method for conventional rice varieties Huai rice No.5 and No.18 based on InDel marks. 24 pairs of peculiar DNA primers designed according to inserted / missing difference segments obtained through comparison of whole-genome DNA sequences of a japonica rice variety Nipponbare and an indica type rice variety 93-11 are used for performing DNA extraction, DNA segment amplification, electrophoretic separation and electrophoretogram analysis on Huai rice No.5 and No.18 to identify the Huai rice No.5 and No.18 varieties. Specifically, 24 pairs of InDel primers are used for analyzing a fingerprint spectrum obtained on the basis of a polymerase chain reaction and vertical gel plate electrophoresis, and then whether the varieties are conventional rice varieties Huai rice No.5 and No.18 or not is determined according to the electrophoretic band type of 24 InDel loci. The number of required detected samples is small, the method is convenient and rapid to use, the identification result is accurate, and the method is applied to the market for identification of authenticity of the Huai rice No.5 and No.18 varieties.

Description

technical field [0001] The invention belongs to the technical field of biological identification, and relates to an identification method for conventional rice varieties Huaidao No. 5 and Huaidao No. 18 based on InDel markers, that is, a method for identifying conventional rice varieties Huaidao No. 5 by using rice DNA insertion or deletion molecular markers and the method of Huaidao 18. Background technique [0002] Cultivated rice (Oryza sativa L.) is one of the most important food crops in the world with rich genetic diversity. Rice variety identification is of great significance for rice genetic research and variety breeding. Most of the reported methods for identifying rice varieties are the identification of japonica and indica subspecies, such as the "Cheng's index method" based on morphological identification (including six traits: lemma hair, phenol response, panicle length, hull color , leaf hair and grain aspect ratio) and molecular marker-based japonica-indica ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6895C12Q2600/156
Inventor 袁政张大兵朱明超袁彩勇韦娇君倪向群文正怀严卫古张锦萍
Owner JIANGSU TIANFENG SEEDS IND CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com