Glucose oxidase gene GOD, protein coded by GOD, pichia pastoris transformed by GOD and preparation method of pichia pastoris
A technology of glucose oxidase and oxidase, which is applied in the field of preparation of new genes, can solve the problems of low enzyme activity, cumbersome purification, and many experiments, and achieve the effects of improving fermentation enzyme activity, increasing enzyme production, and improving economic benefits
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Construction of Pichia pastoris
[0039] Glucose oxidase gene GOD sequence and encoded protein sequence in this embodiment Such as figure 1 As shown, its specific preparation and functional identification of glucose oxidase gene GOD include:
[0040] A, the full sequence amplification and cloning of the glucose oxidase gene GOD;
[0041] B. Transformation of Pichia pastoris with the glucose oxidase gene GOD.
[0042] Step A The preparation of the glucose oxidase gene GOD, the preparation method is to use the 5' end ATGAAGTCCACTATTATCACCTCCA and the 3' end CTAGGCACTTTTGGCATAGTCTTCA as specific primers, and use Penicillium pointis DNA as a template, and pre-denature at 98°C for 5 minutes on the amplification instrument; 30 One PCR cycle: 98°C denaturation for 30 seconds, 65°C annealing for 30 seconds, 72°C extension for 1 minute; 72°C extension for 10 minutes for PCR amplification; PCR reactions were carried out according to the following components and dosage: The r...
Embodiment 2
[0048] Verification of enzyme activity of Pichia pastoris in test tube
[0049] The Pichia pastoris Pichia pastoris obtained in Example 1 is used as a production bacterium. After activation, the temperature is 30 ° C and the rotation speed is 200 rpm, and the seed culture solution with an OD600 of about 1.2 is transferred to the YPCS culture with an inoculum size of 2%. Base, cultured at a temperature of 30°C and a rotational speed of 200rpm; when cultured in YPCS medium until the OD600 value was about 1.2, the yeast cells were transferred to YPCS induction medium, and 1% methanol was added every day to induce expression for 3 days.
[0050] Medium: YPD medium for seeds and slant medium: 2% tryptone, 1% yeast extract, 2% glucose; 2% agar was added to the slant medium. The YPCS medium containing 100 μg / mL G418 contains the following raw materials in mass percentage: tryptone 2%, yeast extract 1%, casein hydrolyzate 2%, sorbitol 0.5%.
[0051] Obtained by protein electrophoresi...
Embodiment 3
[0053] Verification of enzyme activity of Pichia pastoris in 10L fermenter
[0054] Inoculate the activated recombinant strain in the YPD medium, inoculate it in the BMGY medium with a 3% inoculation amount at a temperature of 30°C and a rotation speed of 200-250rpm until the OD600≥2. Cultivate at 250rpm until OD600 reaches about 10. The cultured BMGY fermentation broth was put into a 10L fully automatic fermenter with a 10% inoculation amount. The initial liquid volume is 6L, and 4‰PTM1 is added, 6mL of sterile VC is added every 24h by aseptic operation, and 212ml of sterile VB is added by aseptic operation after induction for 48h.
[0055] Bacteria culture stage: 18-24h with aeration and stirring at 30°C, the glycerol in the medium is gradually consumed, and when the glycerol is exhausted, the bacteria will no longer grow, and DO will suddenly rise at this time and remain stable. During the cultivation process, the pH value was maintained at about 5.0 with ammonia water, a...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap