Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Enzyme-linked immunosorbent assay kit for the detection of methicillin-resistant Staphylococcus aureus

An enzyme-linked immunosorbent reagent, methicillin-resistant technology, applied in antibacterial immunoglobulins, measuring devices, antibacterial drugs, etc., can solve the problems of cumbersome processing operations, false positives, false negatives, etc. Simple operation and high sensitivity effect

Active Publication Date: 2019-01-29
RAYBIOTECH INC GUANGZHOU
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, PCR is very sensitive, and sometimes false positives may occur due to laboratory contamination. In order to make PCR more reliable, probe hybridization or sequencing must be performed on its amplified products to improve specificity.
However, some drug-resistant genes are silent genes, do not express the mec A gene product, and sometimes have false negatives. Therefore, molecular biology methods are not 100% sensitive and specific. In addition, the preliminary treatment of this method is cumbersome and requires certain equipment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Enzyme-linked immunosorbent assay kit for the detection of methicillin-resistant Staphylococcus aureus
  • Enzyme-linked immunosorbent assay kit for the detection of methicillin-resistant Staphylococcus aureus
  • Enzyme-linked immunosorbent assay kit for the detection of methicillin-resistant Staphylococcus aureus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Preparation of PBP2α protein.

[0028] (1) Cloning of mecA target gene

[0029] The amino acid sequence ID number of PBP2α protein is EUE27353.

[0030] The mecA gene encodes PBP2α protein, and its gene sequence is derived from JBDL01000002 (http: / / www.ncbi.nlm.nih.gov / protein / EUE27353).

[0031] According to the mecA gene sequence, two primers were designed as follows:

[0032] ATCTTCACCAACACCTAGTT;

[0033] ATGAAAAAGATAAAAATTGT.

[0034] The expression mecA target gene was amplified by PCR, and the vector pET-28a and the mecA gene fragment purified by agarose gel were subjected to double digestion treatment with NcoI+XhoI, and the purified digestion product was ligated with T4DNA ligase to obtain Recombined plasmid pET-28a-PBP2α, and the ligated product was transformed into Escherichia coli DH5α, clones were selected on LB plates containing ampicillin, plasmids were prepared in small quantities, positive clones were screened out by double enzyme digesti...

Embodiment 2

[0040] Embodiment 2: the preparation of monoclonal antibody

[0041] 1) Establishment of mouse anti-PBP2α hybridoma cell line and identification of monoclonal antibody subtypes

[0042] a. The immunization program adopts 4 basic immunizations and 1 booster immunization. Select 2 healthy female BalB / c mice aged 6-8 weeks, weighing about 18g, and feed them for 1 week, and collect negative blood as a control;

[0043] b. Adopt a medium-range immunization program (0.3mL / monkey, 2 weeks / time), at the first immunization (50μg / mouse), stir and emulsify the immunogen with an equal volume of Freund's complete adjuvant, inject it subcutaneously at multiple points on the back, and then press Stir and emulsify the immunogen with an equal volume of Freund's incomplete adjuvant for routine immunization;

[0044] c. For the third immunization, generally 50 μg of antigen + TiterMax is mixed and emulsified in equal amounts and injected at multiple points on the back, and the titer is measure...

Embodiment 3

[0055] Example 3: Screening of anti-PBP2α antibodies and determination of epitopes

[0056] (1) In this example, the culture supernatant of MRSA bacteria was used as the coating antigen, and the 5 strains of monoclonal antibodies prepared in Example 2 were used as the detection antibodies to be coupled with biotin to establish an indirect ELISA method for detecting PBP2α .

[0057] a) Coating of the microtiter plate

[0058] Coating solution (Na 2 CO 3 1.5g, NaHCO 3 2.9g, Na 2 N 3 1.2g, add ddH 2 (0 to 1 L, adjust the pH to 9.6) Mix the antigen evenly and add it to a 96-well ELISA plate, 100 μl per well, and seal the plate at 4°C overnight.

[0059] b) Sealing of the microtiter plate

[0060] PBS containing 5% skim milk was used as blocking solution. First, pat dry the ELISA plate coated overnight, add 200 μl / well blocking solution, block at 37°C for 2 hours, wash the plate 6 times with a plate washer, pat dry the ELISA plate, and store it at 4°C for later use, or -20...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a monoclonal antibody against a penicillin-binding protein PBP2[alpha], wherein the monoclonal antibody is secreted from a hybridoma cell strain PBP2[alpha]-4B8-G7-H7 with an accession number of CCTCC C2014128. The invention further discloses an enzyme-linked immunoassay kit for detecting methicillin-resistant staphylococcus aureus. A coating antibody is the anti-PBP2[alpha] monoclonal antibody disclosed by the invention. A detection antibody is an HRP labeled PBP2[alpha] polyclonal antibody. The kit disclosed by the invention can be used for detecting methicillin-resistant staphylococcus aureus in a detection sample through the anti-PBP2[alpha] monoclonal antibody and has the characteristics of being simple and convenient, rapid, practical, sensitive and efficient.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a monoclonal antibody against penicillin-binding protein PBP2α and an ELISA kit for detecting methicillin-resistant Staphylococcus aureus. Background technique [0002] Staphylococcus aureus is a clinically common and highly toxic bacterium. Since the advent of penicillin in the 1940s, infectious diseases caused by Staphylococcus aureus have been largely controlled, but with the widespread use of penicillin, some golden yellow Staphylococci produce penicillinase, which can hydrolyze the β-lactam ring, showing resistance to penicillin. Scientists have developed a new semi-synthetic penicillin that is resistant to penicillinase, namely methicillin. After it was applied clinically in 1959, it effectively controlled the infection of Staphylococcus aureus enzyme-producing strains, but Jevons in the United Kingdom discovered methicillin-resistant Staphylococcus aureus (MRSA) for the first t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/12G01N33/577G01N33/569A61K39/40A61P31/04
Inventor 罗树红吕志强方建民黄若磐
Owner RAYBIOTECH INC GUANGZHOU
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More