Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mortierella alpine strain overexpressing 3-phosphoglycerol dehydrogenase gene(G3PD1), and construction method and application thereof

A kind of technology of glycerol phosphate dehydrogenase and Mortierella alpina, which is applied in the field of bioengineering

Active Publication Date: 2015-12-23
JIANGNAN UNIV
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Researchers such as Nguyen found that overexpressing G3PD1 in Saccharomyces cerevisiae increased the activity of 3-glycerol phosphate dehydrogenase by about 4 times, and led to a 20-fold increase in the content of 3-phosphate glycerol in the strain, but its fatty acid content was similar to that of wild type, which means that 3-phosphate glycerol did not affect the triglyceride accumulation of S. cerevisiae

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mortierella alpine strain overexpressing 3-phosphoglycerol dehydrogenase gene(G3PD1), and construction method and application thereof
  • Mortierella alpine strain overexpressing 3-phosphoglycerol dehydrogenase gene(G3PD1), and construction method and application thereof
  • Mortierella alpine strain overexpressing 3-phosphoglycerol dehydrogenase gene(G3PD1), and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of the recombinant Mortierella alpina strain overexpressing the 3-phosphate glycerol dehydrogenase gene

[0031] 1. Cloning of Mortierella alpina G3PD1

[0032] According to the sequence information of Mortierella alpina (M.alpina) ATCC#32222G3PD1 gene (GeneBank KT344118), primers P1 and P2 were designed. P1 / P2, KOD high-fidelity polymerase, amplify the G3PD1 gene by PCR to obtain the target fragment.

[0033] The PCR program is: 94°C for 3min, 94°C for 30s, 58°C for 30s, 68°C for 1.5min, 30 cycles, 68°C for 5min; get the PCR product, then purify the PCR product, and use 1.2% agarose gel to purify the product Electrophoretic verification.

[0034] P1 (sense): CGG GGTACC CCATGTCTGAAAAAGTAGCACTAATCG

[0035] P2 (antisense): TCCC CCCGGG TTAGATATCCTCGACAATCCTGATG

[0036] 2. Construction of binary expression vector

[0037] 1. Enzyme digestion reaction

[0038] Under the condition of 37°C, the PCR purified product of step (1) and the vector ...

Embodiment 2

[0082] Example 2 Mortierella alpina fatty acid extraction and detection

[0083] (1) The Mortierella alpina prototrophic strain and the engineering strain MA-G3PD1-1 (that is, the Mortierella alpina GPD-1 of the present invention), MA-G3PD1, obtained by screening the Mortierella alpina overexpressing the G3PD1 gene obtained in Example 1 -2, MA-G3PD1-3, MA-G3PD1-4 and MA-G3PD1-5 were inoculated in broth medium, cultured on a shaker at 28°C and 200r / min for 7 days;

[0084] ⑵Collect the bacteria, vacuum freeze-dry to constant weight, weigh the weight of the bacteria, and calculate the biomass;

[0085] (3) Grind the bacteria into powder, weigh 50 mg, and add 2 mL of 4 mol / L hydrochloric acid;

[0086] (4) Water bath at 80°C for 1 hour, and place at -80°C for 15 minutes. repeat. 80℃ water bath for 1h;

[0087] (5) Cool to room temperature, add 1mL methanol, and mix well;

[0088] ⑹ Add 1 mL of chloroform and shake for 10 min. Centrifuge at 6000g for 3min. collect chlorofor...

Embodiment 3

[0096] RT-qPCR detection of G3PD1 transcription level in the positive transformant of embodiment 3

[0097] Primers were designed according to the G3PD1 sequence and the internal reference 18SrDNA sequence:

[0098] P5 (sense): TACGCCAACCTTCAGAGTCAA

[0099] P6 (antisense): TGAGACCATCAACCAATCCACC

[0100] P7 (sense): CGTACTACCGATTGAATGGCTTAG

[0101] P8 (antisense): CCTACGGAAACCTTGTTACGACT

[0102] Mortierella alpine total RNA extraction:

[0103] 1. Take out an appropriate amount of bacteria frozen in liquid nitrogen, add liquid nitrogen to a pre-cooled sterile enzyme-free mortar and grind thoroughly;

[0104] 2. Add 1mL TRIzol (Invitrogen, Carlsbad, CA, USA) to continue grinding to powder, and place at room temperature until dissolved;

[0105] 3. Use an enzyme-free pipette tip to pipette 1 mL of the liquid in the above steps into an enzyme-free centrifuge tube, add 200 μL of chloroform and mix well;

[0106] 4. Centrifuge at 12000rpm, 4°C for 15min and aspirate the su...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant Mortierella alpine strain GPD-1 overexpressing G3PD1 and a construction method. According to the invention, uracil-auxotrophic Mortierella alpine MAU1 is used as a material, Agrobacterium tumefaciens is used for mediation, and a G3PD1-overexpressing recombinant strain with obviously increased lipid content is obtained. Compared with wild Mortierella alpine, the total lipid content of the strain provided in the invention is increased by about 50%, and the transcription amount of G3PD1 is increased by about 2 times; so theoretical and application foundations are laid for subsequent industrial application.

Description

【Technical field】 [0001] The invention relates to an engineering strain overexpressing a 3-phosphate glycerol dehydrogenase gene in Mortierella alpina and a construction method thereof, belonging to the technical field of bioengineering. 【Background technique】 [0002] Polyunsaturated fatty acids (PUFAs) refer to straight-chain fatty acids with two or more double bonds and 16-26 carbon atoms. PUFAs are essential fatty acids for the human body. They are of great significance to the nutrition and health of humans and animals. They have the functions of regulating blood lipids, clearing thrombus, regulating immune function, and strengthening the brain. As the traditional sources of PUFAs can no longer meet the growing market demand, microorganisms that can accumulate polyunsaturated fatty acids have increasingly become research hotspots in the fields of food, medicine, chemical industry and aquaculture. Mortierella alpina (M.alpina) is an oil-producing fungus that industrially...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/15C12N15/63C12N15/53C12P7/64
Inventor 陈海琴陈永泉陈卫杨华郝光飞王鸿超杨芹顾震南张灏
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products