Multiplex DPO-PCR (dual-priming oligonucleotide-polymerase chain reaction) detection kit for sunflower white rust and black stem and application thereof
A technology of white rust bacteria and sunflower, applied in the direction of recombinant DNA technology, microbial measurement/inspection, DNA/RNA fragments, etc., can solve the problems of complex detection process, low specificity, long identification cycle, etc., and achieve high sensitivity, Good specificity and insensitive to annealing temperature
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1, a kind of method that detects sunflower white rust bacterium and sunflower black stem bacterium
[0039] 1. Design of Multiplex DPO-PCR Primer Sets
[0040] According to the large subunit ribosomal RNA gene sequence of the sunflower white rust fungus and the ITS-5.8SrRNA gene sequence of the sunflower black stem fungus, the following multiplex DPO-PCR detection primer sets (primer sequences) for detecting the sunflower white rust fungus and the sunflower black stem fungus were designed The I in is hypoxanthine):
[0041] BS-DPO-F: CGAATTGTAGTCTATCGAGGCCAAGIIIIIIACGCAGGATCC (Sequence 1);
[0042] BS-DPO-R: GGAATGGACAGCGGACGCIIIIIGCTTCCCT (Sequence 2);
[0043] HJ-DPO-F: GATGCCGGTACTCTGGGTCTTTIIIIICATGTACC (Sequence 3);
[0044] HJ-DPO-R: ATTGTTTTGAGGCGAGTTTCCCCIIIIIGGAAACAT (SEQ ID NO: 4);
[0045] Among them, BS-DPO-F and BS-DPO-R are primers for detecting sunflower white rust, and the product size is 307bp; HJ-DPO-F and HJ-DPO-R are primers for detect...
Embodiment 2
[0062] Embodiment 2, the specific detection of multiplex DPO-PCR primer
[0063] 1. Extraction of DNA
[0064] Refer to the kit operation (Plant Genomic DNA Extraction Kit, Cat. No. DP305-02, Tiangen Biotechnology Co., Ltd.) to extract the genomic DNA of the susceptible plants or pure strains (stored in Yili Entry-Exit Inspection and Quarantine Bureau) in Table 2. The specific method is as follows: the non-culturable bacterial strains (numbered 5, 8, 9 in table 2) can directly collect susceptible plants, and the DNA is extracted after liquid nitrogen is fully ground; , 3, 4, 6, 7) After 5-7 days of pure culture, the hyphae were picked and freeze-dried, and then fully ground with liquid nitrogen to extract DNA.
[0065] Table 2. Tested strains
[0066]
[0067] 2. Multiplex DPO-PCR amplification
[0068] Adopt the method for detecting sunflower white rust bacterium and sunflower black stem bacterium of step 2 of embodiment 1, carry out multiple DPO-PCR amplification with ...
Embodiment 3
[0072] Example 3, Detection of Annealing Temperature Sensitivity of Multiplex DPO-PCR Primers
[0073] 1. Extraction of DNA
[0074] The kit method (Plant Genomic DNA Extraction Kit, Cat. No. DP305-02, Tiangen Biotechnology Co., Ltd.) was used to extract the genomic DNA of Helianthus albicans and Helianthus helianthus respectively.
[0075] 2. Multiplex DPO-PCR amplification
[0076] With the genomic DNA of the sunflower white rust fungus and the sunflower black stem fungus obtained in step 1 as a template, adopt the method for simultaneously detecting the sunflower white rust fungus and the sunflower black stem fungus in the step 2 of embodiment 1, with different annealing temperatures (45 ℃, 50°C, 55°C, 60°C, 65°C) for PCR amplification, respectively, and the rest of the reaction conditions were unchanged, to obtain multiple DPO-PCR amplification products respectively.
[0077] 3. Electrophoretic detection of multiplex DPO-PCR amplification products
[0078] After the mul...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com