Acidic beta-glucanase NGlu as well as gene and application thereof
A glucanase and gene technology, which is applied in the fields of genetic engineering and fermentation engineering, can solve the problems of difficulty in filtering wort and beer, reduce the quality of beer, affect the stability of beer, etc., and achieve good digestion ability against pepsin and trypsin. , excellent stability and temperature resistance, and the effect of obvious market competitive advantage
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1. Fermentation culture and enzymatic property test of Aspergillus niger strain producing β-glucanase
[0058] The Aspergillus niger strain AN0803 adopted in the present invention has undergone single and compound mutagenesis treatments such as ultraviolet rays, nitrosoguanidine, diethyl sulfate (DES), high-energy ion beams, etc. before use, and can produce α-galactobacter Enzymes such as glycosidase, β-glucanase, β-mannanase, etc.
[0059] The mutant strain AN0803 was fermented and cultured, and the composition of the fermentation medium was as follows:
[0060] 0.5% peptone, 2% soybean flour, 2% wheat flour, 0.5% glucose, 0.25% potassium dihydrogen phosphate, 0.10% magnesium sulfate, natural pH.
[0061] The preparation of the above liquid fermentation culture is based on sterilization at 121°C and 0.1MPa for 30 minutes. After cooling, it is inoculated with Aspergillus niger AN0803 strain, and cultured at 30°C and 200rpm for 4 days.
[0062] After the fermen...
Embodiment 2
[0063] Embodiment 2, cloning of Aspergillus niger (Aspergillus niger) β-glucanase gene
[0064] Use the RNA extraction kit to extract the total RNA of the Aspergillus niger mutant strain (AN0803), and follow the reverse transcriptase SuperScript TM III Reverse Transcriptase Instructions Synthesize the first-strand cDNA, then use the cDNA as a template to design primers for PCR amplification.
[0065] The primers used for amplification are as follows:
[0066] F-NGlu(EcoRI):
[0067] 5'CAGTA GAATTC ATGGACGCCGATGGTGGTC3'
[0068] R-NGlu(NotI):
[0069] 5'CAGTAC GCGGCCGC TTAGGAGCTAGATTGGCACT3'
[0070] After the PCR, the PCR product was purified and digested with EcoRI and NotI, and then connected to the vector pPICzaA that had undergone the same double digestion. The ligated product was transformed into E. coli Topl0 competent cells, and coated with the antibiotic Zeocin on a YPD plate for Screen to obtain positive clones. The plasmids of positive clones were extracted...
Embodiment 3
[0071] Example 3, Construction and Screening of Pichia pastoris Engineering Bacteria Containing Novel β-Glucanase Gene GNGlu
[0072] The obtained recombinant expression vector GNGlu-pPICzaA was linearized with SacI, and the linearized recombinant vector was electroporated to transform Pichia pastoris X33, and after electrotransformation, it was spread on a YPD (Zeo+) plate for screening to obtain a recombinant strain of Pichia pastoris , and cultured statically at 30°C for 3-4 days.
[0073] Conditions for electrotransformation of yeast competent cells: U=1500V, C=25μF, R=200Ω.
[0074] A single colony grown on the YPD (Zeo+) plate was selected for shake flask fermentation culture to induce enzyme production, and the strain with the highest production level of β-glucanase was screened out, and the number was GNGlu-pPICzaA-X33-36.
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap