Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Long-acting interferon, preparation method therefor and applications thereof

An interferon, long-acting technology, applied in the direction of interferon, cytokines/lymphokines/interferon, chemical instruments and methods, etc., can solve the loss of activity of interferon beta, prolong the half-life of interferon beta, and reduce the therapeutic effect of fusion protein and other problems, to achieve the effect of simple preparation process and efficient expression

Inactive Publication Date: 2014-11-19
FUDAN UNIV
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although PEG modification can effectively prolong the half-life of interferon-beta, because PEG modification is a chemical reaction, it may lead to partial loss of activity of interferon-beta; it is reported that PEG cannot be effectively degraded in vivo, and some people produce anti-PEG antibodies, which further limits the long-term development of PEG. Application of Modified Interferon-beta (Garay RP, El-Gewely R, Armstrong JK, Garratty G, Richette P: Expert Opin Drug Deliv 2012, 9(11):1319-1323)
In addition, overlapping PCR technology was used to link interferon-beta cDNA with human serum albumin cDNA, and the fusion gene was integrated into the chromosome of yeast expression host for expression, and a long-acting fusion protein could be obtained; interferon-beta and human immunoglobulin Fusion expression of the Fc fragment of IgG can obtain interferon-beta-Fc fusion protein and prolong the half-life of interferon-beta. However, due to the existence of allotypes of human IgG, repeated administration can lead to the production of antibodies in patients and reduce the therapeutic effect of the fusion protein. (Dumont JA, Low SC, Peters RT, Bitonti AJ: BioDrugs 2006, 20(3):151-160; Vallee S, Rakhe S, Reidy T, Walker S, Lu Q, Sakorafas P, Low S, Bitonti A: J Interferon Cytokine Res 2012, 32(4):178-184; Zhang Q, Lei J, Ding Y, Chen Y, Qu L, Chen S, Jin J: Sheng Wu Gong Cheng Xue Bao 2009, 25(11):1746-1752)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long-acting interferon, preparation method therefor and applications thereof
  • Long-acting interferon, preparation method therefor and applications thereof
  • Long-acting interferon, preparation method therefor and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Chemical modification of recombinant human beta interferon by polysialic acid

[0046] (1) Activation of polysialic acid

[0047] ① Mix polysialic acid with freshly prepared 100mM sodium periodate at a ratio of 10mg polysialic acid / ml sodium periodate, and stir in the dark at 20°C for 5 minutes;

[0048] ② Add twice the volume of ethylene glycol to neutralize excess sodium periodate, place in a dark place at 20°C and continue stirring for 30 minutes;

[0049] ③ Dialyze the oxidized polysialic acid in 0.01% ammonium carbonate buffer (pH7.4) at 4°C for 24 hours, and the dialysis bag should be able to retain 3.5KDa molecules;

[0050] ④ Concentrated polysialic acid solution covered by dry polyethylene glycol with a molecular weight of 8KDa in reverse dialysis;

[0051] ⑤ Freeze-dry the dialysate and store it at -40°C for later use;

[0052] (2) Polysialic acid modified interferon-beta response

[0053] ① Interferon beta was diluted with 0.1% SDS pH7.4 10mM ...

Embodiment 2

[0059] Example 2 Obtaining the Gene Encoding the Fusion Protein of the Hydrophilic Non-repeating Sequence Polypeptide and Interferon-β and Constructing the Expression Vector Containing the Signal Peptide

[0060] Artificial chemical synthesis of the gene sequence encoding the fusion protein of the hydrophilic non-repeating sequence polypeptide and interferon beta, and cloning it into the pUC57 simple plasmid vector to obtain a plasmid containing the gene encoding the fusion protein;

[0061] First, use the fusion protein coding gene sequence in the plasmid as a template, and use Primer to design primers. The upstream primer is: 5'actg CCATGG CCAGCTACAACTTGCTTGGAT 3', where underlined is NCOI Restriction site; downstream primer: 5’agt CTCGAG TCATGGTGCGGTAGAAGAT 3', where underlined is wxya Restriction sites; primers were synthesized by Shanghai Sangon Bioengineering Company;

[0062] cloned by PCR NCOI and wxya The fusion protein coding gene sequence of the enzyme ...

Embodiment 3

[0070] Example 3 Construction of a gene expression vector encoding a hydrophilic non-repeating sequence polypeptide without a signal peptide and an interferon-beta fusion protein

[0071] The gene sequence encoding the fusion protein of hydrophilic non-repeating sequence polypeptide and interferon-beta was artificially synthesized chemically, and cloned into the pUC57 simple plasmid vector to obtain a plasmid containing the gene encoding the fusion protein.

[0072] First, use the fusion protein coding gene sequence in the plasmid as a template, use Primer to design primers, and the upstream primer is: 5' CATATG AGCTACAACTTGCTTGGAT 3’, where underlined is Nd Restriction site; downstream primer: 5’agt CTCGAG TCATGGTGCGGTAGAAGAT 3', where underlined is wxya Restriction sites; primers were synthesized by Shanghai Sangon Bioengineering Company.

[0073] cloned by PCR NCOI and wxya The fusion protein coding gene sequence of the enzyme cutting site was detected by 1% ag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the biological pharmacy field, and relates to a long-acting interferon, a preparation method therefor and applications thereof. The long-acting interferon comprises a polysialic-acid-modified interferon and a long-acting interferon recombination fusion protein. The polysialic acid is subjected to activation by utilization of sodium periodate. The activated polysialic acid reacts with an interferon to form a conjugate in the presence of sodium cyanoborohydride. The recombination fusion protein is composed of an N-end interferon and C-end naturally-existed hydrophilic polypeptides without repeated sequences. The fusion protein can be expressed in escherichia coli with high efficiency, and the preparation technology is simple and can be used for production preparation for large-scale medicine-level fusion proteins. The long-acting interferon can be used for treatment of virus infectious diseases of hepatitis virus, SARS, herpes simplex virus and the like, and is used for treatment of malignant tumors of malignant neuroglioma, lung cancer and the like and other cell proliferative diseases.

Description

Technical field [0001] The invention is the field of biopharmaceuticals, which involves long -acting interferon and preparation methods and uses. It is specifically involved in long -acting interferon and preparation methods and uses for antiviral, anti -infection, antitumor and immune regulation. Background technique [0002] Existing technology has disclosed interferon (Interfereon) is a set of polygen protein secreted by human and animal cells under the induced by bacterial, virus infection or nucleotide.Cytic factors (Pestka S, Langer Ja, Fisher Pb, Weinstein IB, Orgarman RB: Symp Fundam Cancer Res 1984, 37: 261-281; Gutterman ju: Cytokine therapeutics: Proc Natl Acad SCI U S A 1994, 91 (4): 1198-1205).The interferon is mainly types such as α interferon, β interferon, γ interferon, and ω interferon. According to the different sources of cell sources, receptors, amino acid structures, and acid tolerance of acid generatedDivided into type I interferon and type II interferon, wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/555C07K19/00C12N15/62C12N15/63C12N1/21A61K38/21A61K47/48A61P31/12A61P31/14A61P31/20A61P31/22A61P31/00A61P35/00A61P37/02
CPCC07K14/555A61K38/00C07K2319/31
Inventor 鞠佃文李玉彬曾贤钱晓璐范佳君王子玉王绍飞
Owner FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com