Engineering bacteria based on glutamate synthase and implementation method thereof
A small technology of glutamate synthase and glutamate synthase is applied in the field of engineering bacteria based on glutamate synthase, which can solve the problems of low expression and achieve the maintenance of protein activity, protein purity, and stable biology. active effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] This embodiment includes the following steps:
[0028] 1) Isolation and cultivation of Streptomyces grisea
[0029] Streptomyces grisea was isolated from rotten straw collected in Pujiang Town, Shanghai, and the preservation number was CGMCC No.5706. The strain was inoculated in LB liquid medium and cultured at 32°C for 48h.
[0030] The above LB liquid medium components are: peptone 10.0g / L, yeast extract 5.0g / L, NaCl 10.0g / L, pH 6.8-7.2. Add 15.0‐20.0g / L agar to the liquid medium to obtain LB solid medium.
[0031] 2) Genomic DNA extraction
[0032] Collect 2.0 mL of bacterial liquid and centrifuge at 12000 rpm for 2 min. Discard the supernatant, collect the bacterial pellet, add 180 μL lysozyme (20 mg / mL) and 20 μL EDTA solution (0.5M, pH 8.0), treat at 37 °C for 45 min, add 4 μL RNase A (100 mg / mL), shake and mix for 15 s, Leave it at room temperature for 5 minutes, and then complete the remaining operations according to the operating instructions of the bacter...
Embodiment 2
[0054] Glutamate synthase expression vector construction
[0055] 1) According to the sequence of the large subunit and small subunit of glutamate synthase, design primers containing restriction sites, the sequence is as follows:
[0056] GF‐Nde I‐F:GTACATATGTACGACCCCCCGCAACGAGCACGAC
[0057] GF‐EcoR V‐R:GGAATTCTCA ATGATGATGATGATGATG GCCATTGATCGCCGCCT
[0058] GG‐Nco I‐F:ACCATGGCAGATCCCAAGGGTTTCCTCACCAC
[0059] GG‐EcoR I‐R:CGATATCTCA ATGATGATGATGATGATG GACGGTCATGGGCCGGT
[0060] 2) Using Streptomyces griseorubens genomic DNA as a template, use primers containing Nco I and EcoR I restriction sites for PCR amplification to obtain the glutamic acid synthase small subunit gene sequence, using DNA A‐Tailing Add A to Kit and connect to T‐Vector PMD TM 19‐T (TaKaRa), and the ligation product was transferred into DH5α E. coli. Select positive clones on the ampicillin (50 μg / mL) resistance plate, and shake the bacteria to extract the plasmid and sequence it. Then Nco I and Ec...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com