Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

GeXP quick detection kit and detection method for identifying 8 chicken immunosuppression disease pathogens

An immunosuppressive and pathogenic technology, applied in the biological field, can solve the problems of limited quantity, increased probability of dimerization of complex primers, multiplex PCR can not achieve high-throughput rapid detection and analysis, etc., to achieve strong specificity and high sensitivity Effect

Active Publication Date: 2014-10-08
GUANGXI VETERINARY RES INST
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the presence of several pairs of primers in the multiplex PCR reaction system, the probability of forming complex primer dimers is greatly increased, and the number of target genes detected at the same time is limited (mostly 2-4 genes), so that the multiplex PCR cannot reach a high level. The purpose of rapid detection and analysis of throughput

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GeXP quick detection kit and detection method for identifying 8 chicken immunosuppression disease pathogens
  • GeXP quick detection kit and detection method for identifying 8 chicken immunosuppression disease pathogens
  • GeXP quick detection kit and detection method for identifying 8 chicken immunosuppression disease pathogens

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1, the design of PCR primer pair

[0034] Download the sequences of known primers from NCBI, use DNASTAR software for sequence comparison, select highly conserved and specific gene fragments for each target gene, design 8-fold specific primers by primer premier5. Add GeXP universal primers at the 'end, and the primer direction is from the 5' end to the 3' end, as follows:

[0035]1. The primer pair A of the target gene with chicken Marek's disease virus (MDV) meq gene:

[0036] MDV-F1: AGGTGACACTATAGAATAAGGGAGCAGACGTACTATGTAGACAA (sequence 1 in the sequence listing);

[0037] MDV-R1: GTACGACTCACTATAGGGATGGTAAGCAGTCCAAGGGTCA (sequence 2 in the sequence listing);

[0038] The expected length of the amplified product (ie, the target peak position) is 227bp.

[0039] 2. Primer pair B with the A subgroup avian leukemia virus (ALV-A) gp85 gene as the target gene:

[0040] ALV-A-F1: sequence 3 in the sequence listing of AGGTGACACTATAGAATACAAGGGGTTCCTTGGTATCT;

...

Embodiment 2

[0068] Embodiment 2, the specific detection of PCR primer pair

[0069] 1. Template preparation

[0070] 1. Viral RNA extraction and cDNA acquisition

[0071] Extract the RNA of the following sample viruses respectively: avian reovirus v-S1133, S1133, GuangxiR1, GuangxiR2, Guangxi110058 and Guangxi110116, chicken infectious anemia virus GXC060821 and infectious bursal disease virus NN1107 (to extract negative chicken embryo allantois The sample obtained from the solution was the negative control sample). cDNA was obtained by reverse transcription.

[0072] 2. Genomic DNA extraction

[0073] Total genomic DNA of chicken Marek's disease virus, proviral genomic DNA of subgroups A, B, and J avian leukosis virus, and avian reticuloendotheliosis virus were extracted from cell cultures of infected cells after aseptic treatment of diseased chicken tissues (A, B, and J subgroups of avian leukosis virus and avian reticuloendotheliosis virus are retroviruses, and the infection method...

Embodiment 3

[0143] Embodiment 3, the sensitivity detection of PCR primer pair

[0144] 1. Preparation of monoclonal plasmid standards containing target genes

[0145]Chicken Marek's disease virus, A, B and J subgroup avian leukosis virus, avian reticuloendotheliosis virus, avian reovirus, chicken infectious anemia virus and infectious The cDNA or DNA sample of bursal disease virus is template, chicken Marek's disease virus (MDV) meq gene obtained by PCR amplification, A subgroup avian leukemia virus (ALV-A) gp85 gene, B subgroup avian leukemia virus ( ALV-B) gp85 gene, avian leukemia virus subgroup J (ALV-J) gp85 gene, avian reticuloendotheliosis virus (REV) gp90 gene, avian reovirus (ReoV) S1 gene, chicken infectious anemia The full-length cDNA or DNA fragments of the virus (CIAV) VP1 gene and the infectious bursal disease virus (IBDV) VP5 gene were respectively connected with the plasmid pMD18-T vector to obtain 8 recombinant plasmids PA, PB, PC, PD, PE, PF, PG and PH, it was confirme...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a GeXP quick detection kit and detection method for simultaneously identifying 8 chicken infectious immunosuppression disease pathogens. The kit is used on the basis of a GeXP system, and comprises 8 pairs of PCR (polymerase chain reaction) primers. The detection result indicates that the kit has the advantages of high specificity and high sensitivity and can be used for simultaneously identifying and detecting chicken Marek's disease virus, A, B and J subgroup avian leucovirus, avian reticuloendothelium hyperplasia virus, avian reovirus, chicken infectious anemia virus and infectious bursal disease virus.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a GeXP rapid detection kit and a detection method for identifying eight kinds of chicken immunosuppressive disease pathogens. Background technique [0002] Chicken Marek's disease virus, avian leukemia virus of subgroups A, B, and J, avian reticuloendotheliosis virus, avian reovirus, chicken infectious anemia virus, and infectious bursal disease virus are all infectious Viruses that cause immunosuppression in chickens. Infection of chickens with chicken Marek's disease virus, avian leukemia virus of subgroups A, B, and J, and avian reticuloendotheliosis virus can cause tumors in sick chickens and can also cause lifelong immunosuppression. Chickens infected with avian reovirus, chicken infectious anemia virus and infectious bursal disease virus can also suppress the immune function of chickens for a long time. After the chicken is infected with these viruses, the immune function is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/686C12Q1/70C12Q2531/113C12Q2537/143C12Q2565/125
Inventor 谢芝勋曾婷婷谢丽基罗思思邓显文谢志勤范晴刘加波庞耀珊
Owner GUANGXI VETERINARY RES INST
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More