Specific primer pair and probe for detecting ALDH2 (alcohol dehydrogenase 2) gene chip
A specific, primer pair technology, applied in the field of molecular biology, can solve the problems of inaccurate detection results, difficult to meet clinical tests, long detection cycle, etc., achieve good signal-to-noise ratio, avoid uncertain factors, and simple steps.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] The preparation of embodiment 1 gene chip
[0052] Artificially synthesized (Shanghai Sangon Bioengineering Technology Service Co., Ltd.) the following specific probes, dissolved in water to a concentration of 100pmol / ul solution, and then used 2× spotting buffer (product number: BST02010, Shanghai Bio-Tech Co., Ltd.), etc. Than mixed. Next, use the GSM417 sample spotting instrument of Affymetrix Company to spot on the aldehyde-modified glass slide (product number: BSM03011, Shanghai Bio Technology Co., Ltd.) according to the method described in the manual. figure 1 array of . Leave overnight at room temperature.
[0053] Each specific probe sequence is as follows:
[0054] The specific oligonucleotide probe sequence for the detection site 504Glu (GAA) is:
[0055] NH 2 -TTTTTTTTTTTTTTTT CAGGCATACACTGAAGTGAAAA; the sequence of the specific oligonucleotide probe to detect the 504Lys(AAA) site is: NH 2 -TTTTTTTTTTTTTTTTGCAGGCATACACTAAAGTGAAAACT. That is, each of th...
Embodiment 2
[0057] Example 2 Preparation of chromosomal DNA
[0058] Use the blood DNA extraction kit from Shanghai Bio-Tech Co., Ltd. and follow the instructions as follows:
[0059] Adsorption column activation:
[0060] Put the adsorption column in the collection tube, add 500 μL buffer BH1, let it stand for 2-3 minutes, and centrifuge at 12,000 rpm (9,500×g) for 30 s; discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Add 500 μL of buffer BH2 to the adsorption column, centrifuge at 12,000 rpm (9,500×g) for 30 s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube for use.
[0061] Operating procedures:
[0062] (1) Add 20 μL of proteinase K to the bottom of a 1.5 mL centrifuge tube with a pipette.
[0063] (2) Add 200 μL of blood sample into the centrifuge tube.
[0064] (3) Add 200 μL buffer BL to the centrifuge tube, shake and mix for 15 seconds.
[0065] (4) In...
Embodiment 3
[0074] Embodiment 3 uses primer provided by the present invention to amplify ALDH2 gene fragment by PCR method
[0075] Entrust Shanghai Sangon Bioengineering Technology Service Co., Ltd. to synthesize primers, and the primer information is as follows.
[0076] The primer pair sequences for amplification and detection of ALDH2 gene 504Glu / Lys are:
[0077] SEQ ID No.7: Upstream 5'-AAGACTTTGGGGCAATACAG-3',
[0078] SEQ ID No. 8: Downstream 5'-GGGTAAAATTCGGACTCTTC-3'.
[0079] Also, the 5' end of the primer was modified with biotin.
[0080] Then dissolve and dilute to 10 pmol / μl with water. The purchased Taq enzyme (TaKaRa), 10× buffer (TaKaRa), dNTP (Shanghai Sangon Bioengineering Technology Service Co., Ltd.), pure water, and the PCR amplification template obtained in Example 2 were prepared according to the formula in Table 1 below. Addition system:
[0081] Table 1
[0082]
[0083] Use a PCR instrument (TC-96 / G / H (b) PCR amplification instrument, Bioer, Hangzhou) ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com